Incidental Mutation 'R4159:Slc39a6'
ID315680
Institutional Source Beutler Lab
Gene Symbol Slc39a6
Ensembl Gene ENSMUSG00000024270
Gene Namesolute carrier family 39 (metal ion transporter), member 6
SynonymsErmelin
MMRRC Submission 041002-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R4159 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24579881-24603817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24597828 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 362 (V362A)
Ref Sequence ENSEMBL: ENSMUSP00000064667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070726] [ENSMUST00000152504] [ENSMUST00000154205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070726
AA Change: V362A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064667
Gene: ENSMUSG00000024270
AA Change: V362A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 94 141 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
Pfam:Zip 332 753 3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128106
Predicted Effect probably benign
Transcript: ENSMUST00000152504
Predicted Effect probably benign
Transcript: ENSMUST00000154205
AA Change: V78A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122151
Gene: ENSMUSG00000024270
AA Change: V78A

DomainStartEndE-ValueType
Pfam:Zip 48 433 2e-94 PFAM
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele do not display any gross skin abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
4932438A13Rik T A 3: 36,931,083 M854K probably benign Het
Adam4 T G 12: 81,420,032 D605A probably damaging Het
Adcy1 A G 11: 7,063,889 H97R probably damaging Het
Amdhd1 A G 10: 93,534,650 Y109H probably damaging Het
Ankhd1 A G 18: 36,589,540 N372S possibly damaging Het
Aoc2 G A 11: 101,325,296 M68I probably damaging Het
Aspscr1 G A 11: 120,708,676 A377T probably damaging Het
Cacnb1 G C 11: 98,012,274 C154W probably damaging Het
Ccdc186 G A 19: 56,793,492 R27* probably null Het
Clnk C A 5: 38,741,795 probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Fut8 T C 12: 77,393,749 L170P probably damaging Het
G3bp2 T C 5: 92,064,401 H217R probably benign Het
Gm19345 G A 7: 19,854,961 probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Met G T 6: 17,562,272 probably null Het
Mfsd3 T C 15: 76,701,745 L26P probably damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pde8a A G 7: 81,320,659 I510V probably benign Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Phkb T A 8: 86,021,533 probably null Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc15a5 G T 6: 138,072,940 T159K possibly damaging Het
Spef2 A T 15: 9,676,321 D721E probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem173 A T 18: 35,739,219 Y77N probably damaging Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Ttll8 T C 15: 88,917,241 N415D probably benign Het
Ube2d2a A T 18: 35,770,524 probably benign Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Unc79 A G 12: 103,070,253 probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vmn2r102 T A 17: 19,677,826 C368S probably damaging Het
Vmn2r3 G A 3: 64,287,429 Q23* probably null Het
Other mutations in Slc39a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Slc39a6 APN 18 24589745 critical splice donor site probably null
IGL01412:Slc39a6 APN 18 24585356 missense probably damaging 1.00
IGL02182:Slc39a6 APN 18 24601290 missense probably damaging 0.99
IGL02332:Slc39a6 APN 18 24589823 missense probably benign 0.22
IGL02648:Slc39a6 APN 18 24582367 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0729:Slc39a6 UTSW 18 24601470 missense probably benign 0.00
R1128:Slc39a6 UTSW 18 24585292 missense probably damaging 1.00
R1621:Slc39a6 UTSW 18 24600889 missense probably benign 0.08
R1799:Slc39a6 UTSW 18 24585467 missense probably benign 0.00
R1800:Slc39a6 UTSW 18 24585202 missense probably damaging 1.00
R1885:Slc39a6 UTSW 18 24601482 unclassified probably null
R4809:Slc39a6 UTSW 18 24585474 nonsense probably null
R4903:Slc39a6 UTSW 18 24597868 missense probably damaging 1.00
R4994:Slc39a6 UTSW 18 24596294 missense probably damaging 1.00
R5352:Slc39a6 UTSW 18 24601036 missense probably benign 0.00
R5398:Slc39a6 UTSW 18 24597879 missense probably damaging 1.00
R5832:Slc39a6 UTSW 18 24601612 missense possibly damaging 0.81
R6182:Slc39a6 UTSW 18 24600956 missense probably benign 0.16
R6853:Slc39a6 UTSW 18 24599319 missense possibly damaging 0.71
X0065:Slc39a6 UTSW 18 24585375 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAATACCAACAGCAGGAGTCTGAG -3'
(R):5'- ATTACATGAGGGTGCCGTGG -3'

Sequencing Primer
(F):5'- GCGCAATGCCAATGCTC -3'
(R):5'- AAATTCAGCTGCTCTGCTTTACATG -3'
Posted On2015-05-14