Incidental Mutation 'R4224:Acsbg1'
ID319965
Institutional Source Beutler Lab
Gene Symbol Acsbg1
Ensembl Gene ENSMUSG00000032281
Gene Nameacyl-CoA synthetase bubblegum family member 1
SynonymsE230019G03Rik, Bgm, Lpd, BG1
MMRRC Submission 041044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4224 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54604877-54661870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54616041 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 434 (R434H)
Ref Sequence ENSEMBL: ENSMUSP00000034822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034822
AA Change: R434H

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034822
Gene: ENSMUSG00000032281
AA Change: R434H

DomainStartEndE-ValueType
Pfam:AMP-binding 106 570 7.9e-101 PFAM
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene possesses long-chain acyl-CoA synthetase activity. It is thought to play a central role in brain very long-chain fatty acids metabolism and myelinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormalities in gonadotropin induced changes in testosterone production, Leydig cell morphology and long chain and very long chain fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,142,276 probably null Het
Abl2 A G 1: 156,633,847 T440A probably damaging Het
Acat2 T C 17: 12,962,885 probably benign Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp6v1a C A 16: 44,101,811 A355S probably damaging Het
Corin T C 5: 72,343,108 E391G probably damaging Het
Dnah11 T G 12: 118,130,892 S814R probably benign Het
Fam214a T A 9: 75,008,726 N209K probably damaging Het
Fer1l4 A C 2: 156,020,389 V1788G probably benign Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Ica1 T C 6: 8,659,960 K112R probably benign Het
Itpr3 T C 17: 27,107,258 V1334A probably damaging Het
Khdc3 C G 9: 73,102,871 H70D possibly damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mettl21a G T 1: 64,607,956 Y147* probably null Het
Mpp5 A G 12: 78,829,718 K479E probably damaging Het
Mr1 A T 1: 155,130,719 I294N possibly damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Olfr862 T A 9: 19,883,600 Y235F probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rnf213 C T 11: 119,436,823 R1879* probably null Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Tnnt1 T C 7: 4,510,007 H92R probably damaging Het
Trim37 T A 11: 87,216,463 C907S probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Tssk3 T C 4: 129,490,599 D3G probably benign Het
Ubash3a T C 17: 31,237,928 Y521H probably damaging Het
Vmn1r73 T C 7: 11,756,579 I108T probably damaging Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Vps13b A G 15: 35,876,419 T2799A probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Znrd1as T C 17: 36,958,725 probably benign Het
Other mutations in Acsbg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Acsbg1 APN 9 54622428 splice site probably benign
IGL00757:Acsbg1 APN 9 54622719 missense possibly damaging 0.53
IGL01665:Acsbg1 APN 9 54622720 missense probably benign
IGL02213:Acsbg1 APN 9 54615970 missense probably damaging 0.98
R0388:Acsbg1 UTSW 9 54609063 missense probably damaging 1.00
R0426:Acsbg1 UTSW 9 54622746 missense probably benign
R0445:Acsbg1 UTSW 9 54615895 missense probably damaging 1.00
R0644:Acsbg1 UTSW 9 54609826 missense probably damaging 1.00
R1779:Acsbg1 UTSW 9 54616062 missense probably damaging 1.00
R1826:Acsbg1 UTSW 9 54622556 missense possibly damaging 0.90
R5197:Acsbg1 UTSW 9 54622582 missense possibly damaging 0.95
R5435:Acsbg1 UTSW 9 54615869 nonsense probably null
R6241:Acsbg1 UTSW 9 54642662 missense probably damaging 0.99
R6260:Acsbg1 UTSW 9 54628467 unclassified probably null
R6275:Acsbg1 UTSW 9 54609772 missense probably benign 0.00
R6940:Acsbg1 UTSW 9 54609097 missense probably benign 0.00
R7178:Acsbg1 UTSW 9 54628461 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAAGCCTTACCTGTAAAGCCG -3'
(R):5'- ATGTTACATGCAAGGCCAATATCC -3'

Sequencing Primer
(F):5'- GCCTTACCTGTAAAGCCGATAGTTG -3'
(R):5'- GCAAGGCCAATATCCAAAATGTTTAC -3'
Posted On2015-06-12