Incidental Mutation 'R4244:Ccrl2'
ID320349
Institutional Source Beutler Lab
Gene Symbol Ccrl2
Ensembl Gene ENSMUSG00000043953
Gene Namechemokine (C-C motif) receptor-like 2
SynonymsCCR11, Cmkbr1l2, L-CCR
MMRRC Submission 041060-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4244 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111054486-111057519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111055354 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 359 (I359V)
Ref Sequence ENSEMBL: ENSMUSP00000143116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111888] [ENSMUST00000195968] [ENSMUST00000199839]
Predicted Effect probably benign
Transcript: ENSMUST00000111888
AA Change: I359V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107519
Gene: ENSMUSG00000043953
AA Change: I359V

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195968
SMART Domains Protein: ENSMUSP00000143105
Gene: ENSMUSG00000043953

DomainStartEndE-ValueType
Pfam:7tm_1 54 130 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197851
Predicted Effect probably benign
Transcript: ENSMUST00000199839
AA Change: I359V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143116
Gene: ENSMUSG00000043953
AA Change: I359V

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 4.2e-31 PFAM
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,482,521 T551A probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Ap1g1 G A 8: 109,833,490 S281N probably benign Het
Arfgef3 C A 10: 18,630,420 G878V probably damaging Het
Ccdc137 T C 11: 120,462,018 F196S probably damaging Het
Ccdc18 C T 5: 108,148,972 Q214* probably null Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Col6a3 G T 1: 90,786,639 T1683K unknown Het
Copa A G 1: 172,110,718 I524V probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dock5 A G 14: 67,774,582 F1348L probably benign Het
Efcab3 A T 11: 105,111,803 K5664I probably damaging Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Gm9892 A T 8: 52,196,400 noncoding transcript Het
Grm4 A G 17: 27,502,735 I144T probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krt28 G T 11: 99,374,550 S97Y probably damaging Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mfsd2b G T 12: 4,874,356 probably benign Het
Nav3 T C 10: 109,769,296 D972G probably damaging Het
Olfr1167 T C 2: 88,149,288 T244A probably benign Het
Olfr131 C T 17: 38,082,430 V183I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Prex1 G A 2: 166,570,336 R392W probably damaging Het
Ptpn5 C T 7: 47,091,548 W38* probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sh3d21 C T 4: 126,150,718 probably benign Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Slc5a5 A G 8: 70,890,286 V210A probably benign Het
Snx25 A G 8: 46,105,254 C239R probably damaging Het
Sp5 T C 2: 70,477,038 F356L probably damaging Het
Spaca9 T C 2: 28,692,986 I141V probably benign Het
Tbcd T A 11: 121,594,281 L763H probably damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Vwa5a T C 9: 38,737,816 probably benign Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Ccrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02382:Ccrl2 APN 9 111055879 missense probably benign 0.22
IGL02492:Ccrl2 APN 9 111055803 missense probably benign 0.01
octomom UTSW 9 111055987 unclassified probably null
IGL03134:Ccrl2 UTSW 9 111055657 missense probably damaging 1.00
R0321:Ccrl2 UTSW 9 111056211 missense probably damaging 0.97
R0924:Ccrl2 UTSW 9 111055968 missense probably benign 0.39
R0967:Ccrl2 UTSW 9 111055686 missense probably benign 0.02
R2033:Ccrl2 UTSW 9 111055870 missense possibly damaging 0.95
R3720:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R3721:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R5634:Ccrl2 UTSW 9 111055987 unclassified probably null
R7027:Ccrl2 UTSW 9 111055885 missense probably benign 0.11
R7060:Ccrl2 UTSW 9 111055614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACTGAAAGGCTGGCACG -3'
(R):5'- CGCAAGTGTTCAGGTCACAC -3'

Sequencing Primer
(F):5'- GTTTATGGAATGCACACCGC -3'
(R):5'- AGGTCACACAGCTGGTAGC -3'
Posted On2015-06-12