Incidental Mutation 'R4230:Nxpe4'
ID320796
Institutional Source Beutler Lab
Gene Symbol Nxpe4
Ensembl Gene ENSMUSG00000044229
Gene Nameneurexophilin and PC-esterase domain family, member 4
Synonyms
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48162023-48400025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48392822 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 70 (R70G)
Ref Sequence ENSEMBL: ENSMUSP00000149644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093853] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093853
AA Change: R70G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091375
Gene: ENSMUSG00000044229
AA Change: R70G

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Neurexophilin 74 272 8.9e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215780
AA Change: R70G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216998
AA Change: R70G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217002
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Cog6 T C 3: 52,992,808 T511A probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Eme1 G A 11: 94,647,992 T354M possibly damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr373 T C 8: 72,100,344 Y195H probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spag6 T A 2: 18,715,638 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tgm5 T C 2: 121,070,735 T292A probably damaging Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Zc3h12c T A 9: 52,144,428 probably null Het
Other mutations in Nxpe4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nxpe4 APN 9 48394140 missense possibly damaging 0.63
IGL01723:Nxpe4 APN 9 48398598 missense probably benign 0.00
IGL03008:Nxpe4 APN 9 48393438 missense probably benign 0.01
IGL03022:Nxpe4 APN 9 48393248 missense probably damaging 0.99
IGL03271:Nxpe4 APN 9 48393045 missense probably damaging 0.99
R0633:Nxpe4 UTSW 9 48396597 missense probably benign
R1033:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R1186:Nxpe4 UTSW 9 48393392 missense probably benign 0.23
R1296:Nxpe4 UTSW 9 48396493 missense probably benign 0.00
R1596:Nxpe4 UTSW 9 48396555 missense probably damaging 0.97
R1813:Nxpe4 UTSW 9 48393378 missense possibly damaging 0.87
R2511:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R2902:Nxpe4 UTSW 9 48394146 missense probably benign 0.00
R4229:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4231:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4233:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4236:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4296:Nxpe4 UTSW 9 48398984 missense probably damaging 0.98
R5016:Nxpe4 UTSW 9 48392885 missense probably benign 0.12
R5644:Nxpe4 UTSW 9 48392750 missense probably benign 0.00
R5797:Nxpe4 UTSW 9 48396538 missense possibly damaging 0.86
R5979:Nxpe4 UTSW 9 48396562 missense probably benign 0.02
R6170:Nxpe4 UTSW 9 48392804 missense probably benign 0.12
R6208:Nxpe4 UTSW 9 48393378 missense probably benign 0.12
R6431:Nxpe4 UTSW 9 48392845 missense probably damaging 0.99
X0062:Nxpe4 UTSW 9 48399025 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAAACAAAGCTGCCTGTGTG -3'
(R):5'- AGGTGGTCTCTAGCCTCTAC -3'

Sequencing Primer
(F):5'- GCCTGTGTGTGAAATTTTATGACCAC -3'
(R):5'- TCTACCAGGATGTCCAGCTG -3'
Posted On2015-06-12