Mutagenetix > Incidental Mutation

Incidental Mutation 'R4331:Lrpprc'

323599

Institutional Source

Beutler Lab

Gene Symbol

Lrpprc

Ensembl Gene

ENSMUSG00000024120

Gene Name

leucine-rich PPR-motif containing

Synonyms

Lrp130, 3110001K13Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4331 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85012675-85098214 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 85047970 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112308]

AlphaFold

Q6PB66

Predicted Effect

probably null
Transcript: ENSMUST00000112308

SMART Domains

Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	32	50	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:PPR_3	196	228	9.1e-4	PFAM
Pfam:PPR	197	227	2.3e-4	PFAM
Pfam:PPR_3	231	264	7.9e-6	PFAM
Pfam:PPR	232	262	4e-4	PFAM
Pfam:PPR_3	266	297	9.7e-3	PFAM
internal_repeat_2	391	477	3.13e-7	PROSPERO
Pfam:PPR	750	778	3.4e-4	PFAM
low complexity region	1017	1028	N/A	INTRINSIC
internal_repeat_1	1042	1362	1.09e-11	PROSPERO
low complexity region	1366	1375	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160011

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	T	C	15: 83,111,880 (GRCm39)	Y301C	probably damaging	Het
Ahnak	G	A	19: 8,993,184 (GRCm39)	D4823N	probably damaging	Het
Angptl2	A	T	2: 33,118,760 (GRCm39)	D178V	probably damaging	Het
Capn8	A	T	1: 182,432,019 (GRCm39)	D330V	probably damaging	Het
Clec16a	T	C	16: 10,389,533 (GRCm39)	V200A	probably benign	Het
Fcrla	C	T	1: 170,749,245 (GRCm39)	R96Q	possibly damaging	Het
Map4k5	A	T	12: 69,874,148 (GRCm39)	S425T	probably benign	Het
Mthfsl	A	G	9: 88,570,834 (GRCm39)	V195A	probably damaging	Het
Myocd	A	T	11: 65,114,590 (GRCm39)	H49Q	probably benign	Het
Nlk	A	G	11: 78,481,774 (GRCm39)	I229T	possibly damaging	Het
Plxna4	G	A	6: 32,127,480 (GRCm39)	Q1876*	probably null	Het
Ramp1	C	T	1: 91,151,067 (GRCm39)	T144I	possibly damaging	Het
Rhbdf2	A	G	11: 116,493,122 (GRCm39)	Y375H	probably damaging	Het
Scpep1	G	A	11: 88,826,729 (GRCm39)	Q236*	probably null	Het
Ssc5d	G	A	7: 4,945,725 (GRCm39)	G919D	probably benign	Het
Vmn1r60	A	T	7: 5,547,364 (GRCm39)	C245*	probably null	Het
Vmn2r103	T	A	17: 20,014,495 (GRCm39)	M429K	probably benign	Het
Zfp28	A	T	7: 6,396,700 (GRCm39)	Q378H	probably benign	Het

Other mutations in Lrpprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Lrpprc	APN	17	85,057,953 (GRCm39)	missense	possibly damaging	0.91
IGL01319:Lrpprc	APN	17	85,012,840 (GRCm39)	utr 3 prime	probably benign
IGL01380:Lrpprc	APN	17	85,030,158 (GRCm39)	missense	probably benign
IGL01560:Lrpprc	APN	17	85,015,547 (GRCm39)	missense	probably benign	0.07
IGL01582:Lrpprc	APN	17	85,061,971 (GRCm39)	missense	probably null	0.00
IGL01996:Lrpprc	APN	17	85,080,698 (GRCm39)	missense	probably benign
IGL02109:Lrpprc	APN	17	85,033,998 (GRCm39)	nonsense	probably null
IGL02163:Lrpprc	APN	17	85,060,900 (GRCm39)	missense	probably damaging	0.97
IGL02248:Lrpprc	APN	17	85,078,895 (GRCm39)	missense	probably damaging	0.99
IGL02503:Lrpprc	APN	17	85,033,767 (GRCm39)	missense	probably benign
IGL02545:Lrpprc	APN	17	85,082,853 (GRCm39)	missense	probably benign
IGL02570:Lrpprc	APN	17	85,057,981 (GRCm39)	missense	probably damaging	1.00
IGL02636:Lrpprc	APN	17	85,060,532 (GRCm39)	unclassified	probably benign
IGL02943:Lrpprc	APN	17	85,078,878 (GRCm39)	missense	probably benign	0.00
IGL03008:Lrpprc	APN	17	85,058,675 (GRCm39)	missense	probably benign	0.05
elusory	UTSW	17	85,020,215 (GRCm39)	missense	probably benign	0.01
phantom	UTSW	17	85,079,575 (GRCm39)	missense	probably damaging	1.00
R6807_Lrpprc_629	UTSW	17	85,056,531 (GRCm39)	missense	possibly damaging	0.93
Stereotype	UTSW	17	85,074,483 (GRCm39)	missense	probably damaging	1.00
thus	UTSW	17	85,078,355 (GRCm39)	missense	probably benign	0.01
P0023:Lrpprc	UTSW	17	85,033,766 (GRCm39)	missense	probably benign	0.00
R0027:Lrpprc	UTSW	17	85,074,435 (GRCm39)	nonsense	probably null
R0027:Lrpprc	UTSW	17	85,074,435 (GRCm39)	nonsense	probably null
R0302:Lrpprc	UTSW	17	85,047,506 (GRCm39)	missense	possibly damaging	0.76
R0389:Lrpprc	UTSW	17	85,060,540 (GRCm39)	critical splice donor site	probably null
R0448:Lrpprc	UTSW	17	85,078,322 (GRCm39)	missense	probably benign	0.09
R1396:Lrpprc	UTSW	17	85,033,731 (GRCm39)	missense	possibly damaging	0.68
R1759:Lrpprc	UTSW	17	85,047,509 (GRCm39)	missense	probably damaging	1.00
R2019:Lrpprc	UTSW	17	85,059,759 (GRCm39)	missense	possibly damaging	0.56
R2169:Lrpprc	UTSW	17	85,077,505 (GRCm39)	missense	probably benign	0.00
R2312:Lrpprc	UTSW	17	85,080,686 (GRCm39)	missense	probably damaging	0.96
R2319:Lrpprc	UTSW	17	85,033,818 (GRCm39)	missense	probably benign
R2568:Lrpprc	UTSW	17	85,034,077 (GRCm39)	missense	probably damaging	1.00
R3013:Lrpprc	UTSW	17	85,074,497 (GRCm39)	missense	probably benign	0.04
R3620:Lrpprc	UTSW	17	85,077,452 (GRCm39)	missense	probably benign	0.01
R3789:Lrpprc	UTSW	17	85,078,956 (GRCm39)	missense	probably benign	0.25
R3848:Lrpprc	UTSW	17	85,078,355 (GRCm39)	missense	probably benign	0.01
R3973:Lrpprc	UTSW	17	85,078,269 (GRCm39)	critical splice donor site	probably null
R4111:Lrpprc	UTSW	17	85,033,766 (GRCm39)	missense	probably benign	0.00
R4164:Lrpprc	UTSW	17	85,038,617 (GRCm39)	missense	possibly damaging	0.47
R4531:Lrpprc	UTSW	17	85,020,215 (GRCm39)	missense	probably benign	0.01
R4832:Lrpprc	UTSW	17	85,014,584 (GRCm39)	missense	probably benign	0.24
R4947:Lrpprc	UTSW	17	85,078,966 (GRCm39)	missense	probably benign	0.02
R5134:Lrpprc	UTSW	17	85,058,684 (GRCm39)	missense	probably benign	0.00
R5333:Lrpprc	UTSW	17	85,097,821 (GRCm39)	missense	probably benign	0.01
R5950:Lrpprc	UTSW	17	85,047,598 (GRCm39)	missense	possibly damaging	0.86
R5972:Lrpprc	UTSW	17	85,020,250 (GRCm39)	missense	possibly damaging	0.88
R6185:Lrpprc	UTSW	17	85,074,452 (GRCm39)	missense	probably benign
R6253:Lrpprc	UTSW	17	85,048,065 (GRCm39)	missense	probably benign	0.00
R6488:Lrpprc	UTSW	17	85,058,781 (GRCm39)	missense	probably damaging	1.00
R6807:Lrpprc	UTSW	17	85,056,531 (GRCm39)	missense	possibly damaging	0.93
R6911:Lrpprc	UTSW	17	85,063,711 (GRCm39)	missense	possibly damaging	0.67
R6933:Lrpprc	UTSW	17	85,030,131 (GRCm39)	missense	probably benign	0.42
R6955:Lrpprc	UTSW	17	85,084,417 (GRCm39)	missense	probably damaging	0.98
R7448:Lrpprc	UTSW	17	85,079,567 (GRCm39)	missense	probably damaging	0.99
R7727:Lrpprc	UTSW	17	85,084,375 (GRCm39)	missense	probably benign	0.00
R8003:Lrpprc	UTSW	17	85,059,745 (GRCm39)	missense	probably benign	0.01
R8178:Lrpprc	UTSW	17	85,079,575 (GRCm39)	missense	probably damaging	1.00
R8310:Lrpprc	UTSW	17	85,080,524 (GRCm39)	missense	probably damaging	1.00
R8322:Lrpprc	UTSW	17	85,047,496 (GRCm39)	critical splice donor site	probably null
R8389:Lrpprc	UTSW	17	85,080,742 (GRCm39)	missense	possibly damaging	0.79
R8560:Lrpprc	UTSW	17	85,047,495 (GRCm39)	splice site	probably benign
R8777:Lrpprc	UTSW	17	85,058,657 (GRCm39)	missense	probably benign	0.30
R8777-TAIL:Lrpprc	UTSW	17	85,058,657 (GRCm39)	missense	probably benign	0.30
R8868:Lrpprc	UTSW	17	85,078,920 (GRCm39)	missense	probably damaging	0.99
R8970:Lrpprc	UTSW	17	85,074,483 (GRCm39)	missense	probably damaging	1.00
R9042:Lrpprc	UTSW	17	85,059,736 (GRCm39)	critical splice donor site	probably null
R9493:Lrpprc	UTSW	17	85,015,548 (GRCm39)	missense	probably damaging	0.99
R9664:Lrpprc	UTSW	17	85,020,262 (GRCm39)	missense	probably damaging	0.99
X0026:Lrpprc	UTSW	17	85,018,090 (GRCm39)	missense	probably benign	0.42
Z1088:Lrpprc	UTSW	17	85,077,928 (GRCm39)	critical splice acceptor site	probably null
Z1088:Lrpprc	UTSW	17	85,039,212 (GRCm39)	nonsense	probably null
Z1176:Lrpprc	UTSW	17	85,077,859 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTAGCACATACTGATGGC -3'
(R):5'- TGTTGTTTCTGAGAGCCTAAACTG -3'

Sequencing Primer
(F):5'- GCTAGCACATACTGATGGCATTAC -3'
(R):5'- GTTTCTGAGAGCCTAAACTGAATTTG -3'

Posted On

2015-06-24