Incidental Mutation 'R4323:Fbxo38'
ID323935
Institutional Source Beutler Lab
Gene Symbol Fbxo38
Ensembl Gene ENSMUSG00000042211
Gene NameF-box protein 38
Synonyms6030410I24Rik, SP329
MMRRC Submission 041094-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4323 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location62504069-62548743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62515161 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 769 (M769L)
Ref Sequence ENSEMBL: ENSMUSP00000047541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048688]
Predicted Effect probably benign
Transcript: ENSMUST00000048688
AA Change: M769L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047541
Gene: ENSMUSG00000042211
AA Change: M769L

DomainStartEndE-ValueType
Pfam:F-box 29 66 2.6e-5 PFAM
SCOP:d1fqva2 127 357 6e-4 SMART
low complexity region 493 525 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 705 728 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,547,311 Y414C probably damaging Het
Akr1b3 T C 6: 34,310,927 T166A probably benign Het
Ankhd1 C T 18: 36,578,633 S94L probably damaging Het
B4galt3 G T 1: 171,275,942 M68I possibly damaging Het
Bpnt1 A C 1: 185,356,589 H312P probably benign Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Clasp2 T C 9: 113,889,959 V724A possibly damaging Het
Copa G T 1: 172,119,264 C1022F probably damaging Het
Cwf19l2 T G 9: 3,430,452 F261L probably damaging Het
Esr1 G A 10: 5,001,307 V562M possibly damaging Het
Fap T C 2: 62,503,372 H643R probably damaging Het
Fgfr1 A G 8: 25,573,899 N814S probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Itsn1 G A 16: 91,818,552 probably benign Het
Jam2 T C 16: 84,822,856 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Med23 T C 10: 24,870,705 I14T probably benign Het
Mitf A G 6: 97,991,949 Y10C probably benign Het
Mpo T C 11: 87,796,039 S165P probably damaging Het
Neb T G 2: 52,264,110 M2330L possibly damaging Het
Nup214 T C 2: 31,994,684 S486P probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Parp6 G A 9: 59,630,686 V205I possibly damaging Het
Pate2 A T 9: 35,670,471 probably benign Het
Pdss1 T C 2: 22,912,596 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slitrk3 A G 3: 73,050,785 L218P probably damaging Het
Sltm T C 9: 70,580,247 I521T probably benign Het
Smchd1 A G 17: 71,428,275 I618T probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Sp8 A G 12: 118,848,436 I9V probably benign Het
Usp9y T A Y: 1,434,407 M352L possibly damaging Het
Vmn1r46 T C 6: 89,976,367 M66T probably benign Het
Vmn2r111 A T 17: 22,573,178 N32K probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Vps13d T A 4: 145,152,778 T1486S probably benign Het
Wdr55 A G 18: 36,763,100 N281S probably benign Het
Zswim6 G A 13: 107,889,403 noncoding transcript Het
Other mutations in Fbxo38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Fbxo38 APN 18 62530800 missense possibly damaging 0.59
IGL01384:Fbxo38 APN 18 62522416 missense probably damaging 0.98
IGL01443:Fbxo38 APN 18 62533670 missense probably damaging 1.00
IGL01515:Fbxo38 APN 18 62518571 missense probably benign 0.00
IGL01621:Fbxo38 APN 18 62522524 splice site probably benign
IGL01975:Fbxo38 APN 18 62515413 missense probably damaging 1.00
IGL02148:Fbxo38 APN 18 62536227 missense probably benign 0.02
IGL02390:Fbxo38 APN 18 62533589 missense probably damaging 1.00
IGL03040:Fbxo38 APN 18 62527252 missense probably damaging 1.00
IGL03088:Fbxo38 APN 18 62522472 missense possibly damaging 0.86
IGL03290:Fbxo38 APN 18 62526163 missense probably benign 0.08
FR4976:Fbxo38 UTSW 18 62515347 small deletion probably benign
R0526:Fbxo38 UTSW 18 62505980 missense probably damaging 1.00
R0529:Fbxo38 UTSW 18 62505986 missense probably damaging 1.00
R0789:Fbxo38 UTSW 18 62515499 missense possibly damaging 0.84
R1232:Fbxo38 UTSW 18 62510811 missense probably damaging 1.00
R1857:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1859:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1872:Fbxo38 UTSW 18 62517023 missense probably benign 0.01
R2114:Fbxo38 UTSW 18 62506640 missense possibly damaging 0.71
R2910:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R2911:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R3406:Fbxo38 UTSW 18 62514843 missense probably damaging 0.99
R3731:Fbxo38 UTSW 18 62515328 small deletion probably benign
R3792:Fbxo38 UTSW 18 62533462 intron probably null
R3848:Fbxo38 UTSW 18 62515073 missense possibly damaging 0.87
R3948:Fbxo38 UTSW 18 62529544 splice site probably benign
R4151:Fbxo38 UTSW 18 62515328 small deletion probably benign
R4456:Fbxo38 UTSW 18 62526249 missense probably damaging 1.00
R4786:Fbxo38 UTSW 18 62529674 missense probably damaging 1.00
R4829:Fbxo38 UTSW 18 62518591 missense probably benign
R4959:Fbxo38 UTSW 18 62522507 missense probably benign 0.45
R5274:Fbxo38 UTSW 18 62515069 missense probably damaging 0.98
R5288:Fbxo38 UTSW 18 62540971 missense probably benign
R5384:Fbxo38 UTSW 18 62540971 missense probably benign
R5385:Fbxo38 UTSW 18 62540971 missense probably benign
R5448:Fbxo38 UTSW 18 62522457 missense possibly damaging 0.59
R5540:Fbxo38 UTSW 18 62514793 critical splice donor site probably null
R5588:Fbxo38 UTSW 18 62526177 missense probably damaging 1.00
R5617:Fbxo38 UTSW 18 62505971 missense probably damaging 1.00
R5636:Fbxo38 UTSW 18 62511018 missense possibly damaging 0.80
R5769:Fbxo38 UTSW 18 62514965 missense probably benign 0.10
R6254:Fbxo38 UTSW 18 62505500 synonymous probably null
R6315:Fbxo38 UTSW 18 62536147 nonsense probably null
R6517:Fbxo38 UTSW 18 62533563 missense probably damaging 1.00
R6673:Fbxo38 UTSW 18 62533915 missense probably damaging 1.00
R6974:Fbxo38 UTSW 18 62506669 missense possibly damaging 0.95
R7022:Fbxo38 UTSW 18 62536224 missense probably damaging 1.00
R7175:Fbxo38 UTSW 18 62515473 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTGTGGCAGAGTCCTAAAGG -3'
(R):5'- AGCAGCTAGGGATGTTTCTG -3'

Sequencing Primer
(F):5'- GAAAAGGCGGATCTCGTACCATC -3'
(R):5'- ATGTCTATCCCAGCTGCAGCAG -3'
Posted On2015-06-24