Incidental Mutation 'R4406:Trak1'
ID327667
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
MMRRC Submission 041688-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R4406 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121431536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000147604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000209211] [ENSMUST00000209995] [ENSMUST00000210351] [ENSMUST00000210636] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
Predicted Effect probably damaging
Transcript: ENSMUST00000045903
AA Change: V114A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: V114A

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209211
Predicted Effect unknown
Transcript: ENSMUST00000209995
AA Change: V11A
Predicted Effect probably damaging
Transcript: ENSMUST00000210351
AA Change: V64A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210636
AA Change: V114A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210798
AA Change: V11A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211187
AA Change: V104A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211301
AA Change: V11A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211439
AA Change: V11A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211699
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,280,449 L1170F probably benign Het
Acss3 A T 10: 107,053,337 D207E probably damaging Het
Adgrl1 T C 8: 83,930,042 S325P probably damaging Het
Ankrd37 A G 8: 45,997,094 probably benign Het
Atp13a2 C T 4: 141,006,476 P1059S probably damaging Het
Camkv T C 9: 107,946,219 probably null Het
Ces1f T C 8: 93,263,322 T387A probably benign Het
Dmxl1 T A 18: 49,889,553 L1653I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat2 G A 11: 55,262,268 A3706V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm1527 G A 3: 28,895,725 V45M possibly damaging Het
Gm5084 A G 13: 60,212,566 noncoding transcript Het
Itpr1 T A 6: 108,354,663 H194Q probably damaging Het
Kif24 A T 4: 41,393,954 L973Q probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Ly75 T C 2: 60,354,550 E420G probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mib1 A C 18: 10,763,289 K446N probably damaging Het
Mrpl4 T C 9: 21,006,935 W146R probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Olfr1385 G A 11: 49,494,917 R128H probably benign Het
Olfr1411 T A 1: 92,597,314 M265K possibly damaging Het
Olfr1446 A T 19: 12,890,234 Y114* probably null Het
Olfr1458 A G 19: 13,102,594 S237P possibly damaging Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Osbpl10 C T 9: 115,109,481 H70Y probably damaging Het
Pdilt A C 7: 119,495,009 S340A probably damaging Het
Ppan C A 9: 20,890,992 D226E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sema3g G A 14: 31,228,159 V766M probably benign Het
Skint6 T A 4: 113,156,486 N356I probably benign Het
Slco2b1 A T 7: 99,664,889 S496T probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Umod G A 7: 119,466,064 P581S probably damaging Het
Zfat A G 15: 68,180,191 S585P probably benign Het
Zfp472 C A 17: 32,978,160 T403N probably benign Het
Zfp936 A G 7: 43,190,324 Q405R possibly damaging Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6399:Trak1 UTSW 9 121453496 intron probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7304:Trak1 UTSW 9 121416212 missense probably benign
R7396:Trak1 UTSW 9 121448907 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTCAGTGGGTAACTCACAGC -3'
(R):5'- AGGCCTAGGGATAAAGCTCCTC -3'

Sequencing Primer
(F):5'- TGGGTAACTCACAGCCCAGC -3'
(R):5'- CTGGTCTACATAGCAAGTTCCAGG -3'
Posted On2015-07-07