Incidental Mutation 'R4631:Trak1'
ID349203
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
MMRRC Submission 041896-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4631 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121454425 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 419 (R419Q)
Ref Sequence ENSEMBL: ENSMUSP00000148026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
Predicted Effect probably benign
Transcript: ENSMUST00000045903
AA Change: R522Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: R522Q

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209446
AA Change: R43Q
Predicted Effect probably benign
Transcript: ENSMUST00000210798
AA Change: R419Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211187
AA Change: R512Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000211301
AA Change: R419Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211439
AA Change: R419Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211699
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,257,987 L368Q probably damaging Het
Abcc2 C T 19: 43,814,707 P661S possibly damaging Het
Adgre4 T G 17: 55,814,305 M457R probably null Het
Ank C A 15: 27,467,090 F29L probably benign Het
Arhgap20 T C 9: 51,840,353 probably benign Het
Atf6 T C 1: 170,747,197 probably null Het
Bod1l A G 5: 41,817,735 F2079L probably damaging Het
Cd163 T C 6: 124,329,086 *1122Q probably null Het
Ces2g T C 8: 104,967,462 probably null Het
Cntnap3 A G 13: 64,778,883 Y558H probably benign Het
Ctsm T A 13: 61,537,696 S301C probably null Het
Dlc1 A C 8: 36,937,558 probably null Het
Dlg2 A T 7: 92,088,614 I435F probably damaging Het
Dnah5 T C 15: 28,401,953 V3420A probably damaging Het
Dnah5 T A 15: 28,419,994 Y3813N probably damaging Het
Dnajc13 A G 9: 104,190,417 M1181T probably damaging Het
Drc3 C A 11: 60,364,908 T107N probably benign Het
Dydc2 T C 14: 41,049,329 E131G probably benign Het
Eif5b T C 1: 38,041,747 V723A probably damaging Het
Fndc9 C A 11: 46,237,848 H65N possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Gm1966 A G 7: 106,599,523 noncoding transcript Het
Gm38394 A T 1: 133,658,744 V285E probably damaging Het
Gm5096 G A 18: 87,756,401 R16H probably damaging Het
Gps1 T A 11: 120,788,239 probably null Het
Kazn G A 4: 142,118,160 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnip1 T A 11: 33,992,821 noncoding transcript Het
Kif19a A G 11: 114,784,847 I382V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Malsu1 A T 6: 49,084,533 E177V probably damaging Het
Man2a2 A G 7: 80,362,463 F649L probably benign Het
Map3k11 A G 19: 5,690,913 I223V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh9 T G 15: 77,797,028 D164A probably damaging Het
Myo16 T C 8: 10,506,984 I1040T probably damaging Het
Myo18b C T 5: 112,846,400 A896T probably damaging Het
Myocd G T 11: 65,178,859 N798K probably benign Het
Olfr1206 C T 2: 88,864,830 T75I probably benign Het
Olfr1288 T A 2: 111,479,563 W260R probably damaging Het
Olfr1458 T A 19: 13,103,272 I11F probably benign Het
Olfr156 T C 4: 43,820,563 D266G probably benign Het
Olfr168 G A 16: 19,530,141 R260* probably null Het
Olfr353 T G 2: 36,890,618 T77P probably benign Het
Olfr68 A T 7: 103,777,475 L290Q probably damaging Het
Pcdh18 T A 3: 49,756,441 I142F probably damaging Het
Pcyox1 T C 6: 86,389,143 D363G probably benign Het
Pcyox1 T C 6: 86,389,230 E334G possibly damaging Het
Pgm1 A G 5: 64,105,947 probably null Het
Plagl1 T G 10: 13,127,999 probably benign Het
Ppp1r9a A G 6: 4,906,537 D364G possibly damaging Het
Rab2b T A 14: 52,266,242 H141L possibly damaging Het
Rev3l A G 10: 39,828,416 K279E probably benign Het
Rnf111 G T 9: 70,450,396 T607N probably benign Het
Scn8a C A 15: 101,016,503 S1130* probably null Het
Selenbp1 A G 3: 94,944,568 *473W probably null Het
Sh3bp4 A C 1: 89,144,273 D281A probably damaging Het
Skint5 T A 4: 113,629,117 probably null Het
Slc1a4 A G 11: 20,308,452 L249P probably damaging Het
Slc45a2 T A 15: 11,012,576 S222T probably benign Het
Slc7a4 A G 16: 17,574,391 F393S probably damaging Het
Slc9a2 A T 1: 40,761,918 D536V possibly damaging Het
Stra6 T A 9: 58,140,832 probably benign Het
Tmem145 A G 7: 25,307,825 D156G probably benign Het
Tns3 A C 11: 8,451,119 F1060V probably benign Het
Trappc8 A G 18: 20,867,808 S273P probably benign Het
Trmt11 A G 10: 30,559,204 S320P probably benign Het
Ugt1a6a A T 1: 88,139,258 Y262F probably benign Het
Vmn1r73 G A 7: 11,756,831 C192Y probably benign Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Vmn2r25 T A 6: 123,853,003 D63V possibly damaging Het
Vps13b C T 15: 35,646,132 H1461Y possibly damaging Het
Ythdc2 A T 18: 44,887,631 E1427D probably benign Het
Zbtb26 A G 2: 37,436,956 F23L probably benign Het
Zfp62 T A 11: 49,217,805 *908R probably null Het
Zfp975 A T 7: 42,662,945 N81K probably benign Het
Zkscan16 G A 4: 58,951,918 V198M probably damaging Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6399:Trak1 UTSW 9 121453496 intron probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7304:Trak1 UTSW 9 121416212 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTTGAGACCCACAGAGG -3'
(R):5'- CTTCGAGTGGCTTCACGATCTG -3'

Sequencing Primer
(F):5'- AGGGAACTCCTTCAGTGGCTG -3'
(R):5'- ACGATCTGCAGCTTCTCGG -3'
Posted On2015-10-08