Incidental Mutation 'R3921:Rnf31'
ID315753
Institutional Source Beutler Lab
Gene Symbol Rnf31
Ensembl Gene ENSMUSG00000047098
Gene Namering finger protein 31
SynonymsPaul, HOIP
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55591708-55603693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55601142 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 857 (Y857H)
Ref Sequence ENSEMBL: ENSMUSP00000019443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000137296] [ENSMUST00000138037]
Predicted Effect probably damaging
Transcript: ENSMUST00000019443
AA Change: Y857H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: Y857H

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably benign
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137296
SMART Domains Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 66 151 6.8e-17 PFAM
Blast:RING 214 257 3e-17 BLAST
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 404 428 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect unknown
Transcript: ENSMUST00000140178
AA Change: Y702H
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: Y702H

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably benign
Transcript: ENSMUST00000227708
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Rnf31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf31 APN 14 55592319 splice site probably null
IGL01532:Rnf31 APN 14 55602623 missense probably damaging 0.99
IGL02118:Rnf31 APN 14 55599112 missense probably damaging 1.00
IGL02272:Rnf31 APN 14 55598782 missense probably damaging 1.00
IGL02893:Rnf31 APN 14 55599109 missense probably damaging 1.00
IGL02939:Rnf31 APN 14 55595674 missense probably benign 0.30
R0285:Rnf31 UTSW 14 55601389 missense probably damaging 0.96
R0678:Rnf31 UTSW 14 55601713 nonsense probably null
R0924:Rnf31 UTSW 14 55593002 unclassified probably benign
R1386:Rnf31 UTSW 14 55596764 missense probably damaging 1.00
R1507:Rnf31 UTSW 14 55598982 nonsense probably null
R2122:Rnf31 UTSW 14 55596197 missense probably damaging 1.00
R2164:Rnf31 UTSW 14 55592537 missense possibly damaging 0.90
R3714:Rnf31 UTSW 14 55603394 missense probably damaging 1.00
R4348:Rnf31 UTSW 14 55601098 frame shift probably null
R4349:Rnf31 UTSW 14 55601098 frame shift probably null
R4350:Rnf31 UTSW 14 55601098 frame shift probably null
R4351:Rnf31 UTSW 14 55601098 frame shift probably null
R4353:Rnf31 UTSW 14 55601098 frame shift probably null
R4472:Rnf31 UTSW 14 55603320 missense probably damaging 1.00
R5004:Rnf31 UTSW 14 55592182 missense probably damaging 1.00
R5245:Rnf31 UTSW 14 55601706 missense probably damaging 1.00
R5286:Rnf31 UTSW 14 55592236 missense probably damaging 1.00
R5669:Rnf31 UTSW 14 55596704 missense probably damaging 1.00
R5750:Rnf31 UTSW 14 55598686 missense probably damaging 1.00
R6377:Rnf31 UTSW 14 55595527 missense probably damaging 1.00
R7009:Rnf31 UTSW 14 55592551 missense probably benign 0.00
R7018:Rnf31 UTSW 14 55592233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCCCTCAGTTTTAGGATC -3'
(R):5'- CAGTGCGTACGAGAACTTGC -3'

Sequencing Primer
(F):5'- GCCCTCAGTTTTAGGATCTAAGTG -3'
(R):5'- CGAGAACTTGCATTTCGGAC -3'
Posted On2015-05-15