Incidental Mutation 'R4351:Disp1'
ID 328494
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Name dispatched RND transporter family member 1
Synonyms DispA, 1190008H24Rik
MMRRC Submission 041106-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R4351 (G1)
Quality Score 223
Status Validated
Chromosome 1
Chromosomal Location 182867830-183003086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 182881542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
AlphaFold Q3TDN0
Predicted Effect probably benign
Transcript: ENSMUST00000003035
AA Change: V200A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171366
AA Change: V200A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192915
Predicted Effect probably benign
Transcript: ENSMUST00000195372
AA Change: V200A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aak1 A G 6: 86,912,519 (GRCm39) probably null Het
Abtb2 T A 2: 103,513,738 (GRCm39) D382E possibly damaging Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Adh1 A G 3: 137,986,258 (GRCm39) T82A probably benign Het
Ak6 C T 13: 100,792,111 (GRCm39) Q185* probably null Het
Aldh6a1 A G 12: 84,490,535 (GRCm39) Y27H probably benign Het
Apob A G 12: 8,043,054 (GRCm39) M812V probably benign Het
Arhgef10 C A 8: 15,041,145 (GRCm39) S748* probably null Het
Brd3 A T 2: 27,347,028 (GRCm39) Y369N probably damaging Het
Cracdl A G 1: 37,663,993 (GRCm39) F635S probably benign Het
Dhh A G 15: 98,796,099 (GRCm39) probably benign Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Evx1 A G 6: 52,290,846 (GRCm39) D6G probably damaging Het
Garin1b C G 6: 29,320,800 (GRCm39) I141M probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Hars2 A G 18: 36,919,231 (GRCm39) E123G probably damaging Het
Hsd17b4 A T 18: 50,275,701 (GRCm39) D115V probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Or2v2 A G 11: 49,004,530 (GRCm39) S8P probably damaging Het
Or8g52 T A 9: 39,630,865 (GRCm39) M114K probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rabgap1 A G 2: 37,373,794 (GRCm39) T269A probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Sptbn5 T C 2: 119,913,680 (GRCm39) noncoding transcript Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Tm2d3 A G 7: 65,344,939 (GRCm39) Y49C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Wdr81 A G 11: 75,332,638 (GRCm39) L1921P probably damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
BB016:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R1120:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably benign 0.24
R1482:Disp1 UTSW 1 182,868,038 (GRCm39) missense possibly damaging 0.61
R1655:Disp1 UTSW 1 182,868,568 (GRCm39) missense probably benign 0.01
R1660:Disp1 UTSW 1 182,869,306 (GRCm39) missense probably damaging 1.00
R1816:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably damaging 0.99
R1835:Disp1 UTSW 1 182,870,564 (GRCm39) missense probably damaging 1.00
R1954:Disp1 UTSW 1 182,870,107 (GRCm39) missense probably damaging 0.99
R2025:Disp1 UTSW 1 182,869,767 (GRCm39) missense probably damaging 1.00
R2136:Disp1 UTSW 1 182,869,942 (GRCm39) missense probably damaging 1.00
R2150:Disp1 UTSW 1 182,869,936 (GRCm39) missense probably damaging 1.00
R2207:Disp1 UTSW 1 182,869,906 (GRCm39) missense possibly damaging 0.94
R2392:Disp1 UTSW 1 182,868,731 (GRCm39) missense probably benign
R2831:Disp1 UTSW 1 182,870,883 (GRCm39) small deletion probably benign
R3111:Disp1 UTSW 1 182,869,087 (GRCm39) missense probably damaging 1.00
R3116:Disp1 UTSW 1 182,870,486 (GRCm39) missense probably benign 0.01
R3160:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3161:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3716:Disp1 UTSW 1 182,869,315 (GRCm39) missense probably damaging 1.00
R3914:Disp1 UTSW 1 182,870,666 (GRCm39) missense probably benign 0.05
R4061:Disp1 UTSW 1 182,869,264 (GRCm39) missense probably damaging 0.96
R4191:Disp1 UTSW 1 182,870,737 (GRCm39) missense probably damaging 1.00
R4261:Disp1 UTSW 1 182,870,950 (GRCm39) missense probably damaging 1.00
R4272:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4273:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4672:Disp1 UTSW 1 182,880,215 (GRCm39) critical splice acceptor site probably null
R4764:Disp1 UTSW 1 182,869,660 (GRCm39) missense probably damaging 1.00
R4910:Disp1 UTSW 1 182,917,027 (GRCm39) missense probably damaging 1.00
R5150:Disp1 UTSW 1 182,871,063 (GRCm39) missense probably damaging 0.98
R5502:Disp1 UTSW 1 182,869,450 (GRCm39) missense probably damaging 1.00
R5616:Disp1 UTSW 1 182,869,913 (GRCm39) missense probably benign 0.30
R5699:Disp1 UTSW 1 182,870,119 (GRCm39) nonsense probably null
R5813:Disp1 UTSW 1 182,869,974 (GRCm39) missense probably damaging 1.00
R5820:Disp1 UTSW 1 182,917,151 (GRCm39) missense probably benign 0.00
R6184:Disp1 UTSW 1 182,867,896 (GRCm39) missense probably benign 0.00
R6228:Disp1 UTSW 1 182,880,589 (GRCm39) missense possibly damaging 0.59
R6306:Disp1 UTSW 1 182,868,712 (GRCm39) missense possibly damaging 0.93
R6505:Disp1 UTSW 1 182,868,076 (GRCm39) missense probably benign 0.02
R6925:Disp1 UTSW 1 182,868,042 (GRCm39) missense probably benign
R7016:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7045:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7046:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7047:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7114:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7123:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7124:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7125:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7161:Disp1 UTSW 1 182,869,189 (GRCm39) missense possibly damaging 0.84
R7510:Disp1 UTSW 1 182,869,975 (GRCm39) missense probably damaging 1.00
R7756:Disp1 UTSW 1 182,871,298 (GRCm39) missense probably damaging 1.00
R7800:Disp1 UTSW 1 182,880,550 (GRCm39) missense probably benign 0.00
R7929:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R8029:Disp1 UTSW 1 182,870,852 (GRCm39) missense probably damaging 1.00
R8036:Disp1 UTSW 1 182,870,803 (GRCm39) missense probably damaging 1.00
R8045:Disp1 UTSW 1 182,870,794 (GRCm39) missense probably damaging 1.00
R8054:Disp1 UTSW 1 182,869,812 (GRCm39) nonsense probably null
R8061:Disp1 UTSW 1 182,869,151 (GRCm39) missense probably damaging 1.00
R8094:Disp1 UTSW 1 182,869,192 (GRCm39) missense probably damaging 1.00
R8130:Disp1 UTSW 1 182,917,199 (GRCm39) missense probably benign 0.13
R8731:Disp1 UTSW 1 182,869,072 (GRCm39) missense possibly damaging 0.65
R9076:Disp1 UTSW 1 182,868,799 (GRCm39) missense possibly damaging 0.59
R9490:Disp1 UTSW 1 182,871,092 (GRCm39) missense probably benign 0.03
R9712:Disp1 UTSW 1 182,917,379 (GRCm39) missense probably damaging 0.99
R9745:Disp1 UTSW 1 182,869,310 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACTGGTGGCTGCAGTAAG -3'
(R):5'- AATACCTGCGCTGCTCTAAC -3'

Sequencing Primer
(F):5'- GCTTTGGTGTAAGACTACCTCAGAC -3'
(R):5'- GCTCTAACATATGGGGCTCTAAC -3'
Posted On 2015-07-07