Incidental Mutation 'R0047:Nfkb1'
ID32934
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonymsp50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
MMRRC Submission 038341-MU
Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0047 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location135584655-135691547 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 135595053 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 72 (L72*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
Predicted Effect probably null
Transcript: ENSMUST00000029812
AA Change: L584*
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: L584*

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129428
Predicted Effect probably null
Transcript: ENSMUST00000132668
AA Change: L223*
SMART Domains Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163
AA Change: L223*

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
Blast:IPT 55 156 4e-22 BLAST
ANK 178 208 2.27e1 SMART
ANK 217 246 1.11e-2 SMART
ANK 250 280 2.47e0 SMART
ANK 286 315 5.53e-3 SMART
ANK 320 350 1.9e-1 SMART
ANK 354 383 2.18e-1 SMART
Blast:DEATH 441 505 1e-34 BLAST
PDB:2DBF|A 442 505 5e-32 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150007
Predicted Effect probably null
Transcript: ENSMUST00000164430
AA Change: L584*
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: L584*

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184550
AA Change: L72*
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Acsf2 T C 11: 94,569,342 I395V probably benign Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Ankrd35 A G 3: 96,684,063 K555R probably benign Het
Arhgap35 A T 7: 16,561,992 H1049Q probably benign Het
Arhgef5 G A 6: 43,265,621 probably null Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bhlhe22 T C 3: 18,055,569 L261P probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Cacna1d T G 14: 30,346,790 probably benign Het
Camk2g G A 14: 20,771,068 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Cdkl4 T G 17: 80,550,845 N115T probably benign Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Chia1 G T 3: 106,115,257 C49F probably damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Crh T C 3: 19,694,037 E147G probably damaging Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Ffar4 A G 19: 38,114,004 probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Hrc T A 7: 45,336,689 S421R probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Insr A G 8: 3,202,947 V404A probably damaging Het
Irak2 G T 6: 113,672,953 probably benign Het
Irak2 G A 6: 113,678,738 V367I probably benign Het
Kat7 A C 11: 95,300,208 N119K probably benign Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Klf17 A G 4: 117,761,032 Y43H probably benign Het
Kng2 T A 16: 22,987,563 T629S possibly damaging Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Lrp12 T C 15: 39,878,239 E360G probably damaging Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr186 T A 16: 59,027,224 M228L probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr508 A G 7: 108,630,552 I187V probably benign Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pcdhb5 A T 18: 37,321,268 I234F possibly damaging Het
Pgm5 T A 19: 24,684,556 I545F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rnf219 T A 14: 104,503,344 probably null Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpina3g T A 12: 104,240,284 S115T possibly damaging Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tbx3 A T 5: 119,680,446 E382V probably damaging Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Trim26 T C 17: 36,857,864 probably benign Het
Trmt11 T C 10: 30,535,243 N418S probably benign Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vmn2r77 T C 7: 86,811,650 V728A probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Wdr41 A G 13: 95,010,287 I197V probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Zan A G 5: 137,403,656 M4058T unknown Het
Zfp236 C T 18: 82,680,692 C88Y probably damaging Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Finlay UTSW 3 135595053 nonsense probably null
Frisbee UTSW 3 135613943 missense possibly damaging 0.93
kookaburra UTSW 3 135626611 nonsense probably null
Murgatroyd UTSW 3 135626710 missense possibly damaging 0.72
Poderoso UTSW 3 135613990 missense probably damaging 1.00
puff UTSW 3 135595053 nonsense probably null
Roomba UTSW 3 135612412 critical splice donor site probably null
Wheelo UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
R7175:Nfkb1 UTSW 3 135613990 missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135626659 missense probably damaging 1.00
R7394:Nfkb1 UTSW 3 135613697 missense possibly damaging 0.54
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGCCAAGCCCTTATGCTGC -3'
(R):5'- CCCGACTGTTGAATGCTGGTTCTC -3'

Sequencing Primer
(F):5'- AGCAAGGCGACTGCTCTTAC -3'
(R):5'- AATGCTGGTTCTCTCCGTG -3'
Posted On2013-05-09