Incidental Mutation 'R4644:Rictor'
ID351788
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 041905-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4644 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 6777935 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 728 (C728*)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably null
Transcript: ENSMUST00000061656
AA Change: C728*
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: C728*

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A G 10: 22,066,761 V440A probably benign Het
Adcy10 T G 1: 165,551,361 probably null Het
Ano5 C A 7: 51,587,685 Y702* probably null Het
Bsph2 A T 7: 13,571,017 V11E possibly damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cflar T A 1: 58,731,267 I173N probably damaging Het
Dgkd T C 1: 87,936,294 V904A probably damaging Het
Diexf A G 1: 193,128,480 Y72H probably damaging Het
Dnajc21 T C 15: 10,463,917 D54G possibly damaging Het
Doc2a C A 7: 126,851,446 T298K probably benign Het
Dsg1a A T 18: 20,340,728 I953L probably benign Het
Fga C A 3: 83,030,266 A150E possibly damaging Het
Frem3 T A 8: 80,613,727 M883K probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Klhdc4 G C 8: 121,822,000 probably benign Het
Mgst1 T C 6: 138,156,370 Y50H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nsmaf A G 4: 6,419,940 probably benign Het
Pp2d1 T C 17: 53,515,987 K17R probably benign Het
Prss39 C T 1: 34,502,126 T237M probably damaging Het
Ptpra T C 2: 130,544,158 I595T probably damaging Het
Ptpre C T 7: 135,651,932 probably benign Het
Scn11a C T 9: 119,815,203 probably null Het
Scn1b A T 7: 31,117,787 L170* probably null Het
Slc35f3 A G 8: 126,321,070 R50G possibly damaging Het
Sorcs3 G A 19: 48,683,597 V412M probably damaging Het
Spg11 C T 2: 122,061,029 V1954I probably benign Het
Srcap C T 7: 127,552,598 R2049C probably damaging Het
Ssh2 T C 11: 77,449,576 V518A possibly damaging Het
Stab1 G A 14: 31,140,487 probably benign Het
Tenm2 A G 11: 36,047,136 F1570S probably benign Het
Tpr T A 1: 150,423,499 V1076E probably benign Het
Ttn A T 2: 76,732,413 Y26986* probably null Het
Unc45a C T 7: 80,328,509 A673T probably damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTAGTCTCTGAGAAACTCCATAGAG -3'
(R):5'- AACACTGCCAATTAAGGTGGAATAG -3'

Sequencing Primer
(F):5'- TCCAGGTCTTTCCAGGTA -3'
(R):5'- TAAAATTTTGCCCAAACGAAACTC -3'
Posted On2015-10-08