Incidental Mutation 'R0348:Ints5'
ID36036
Institutional Source Beutler Lab
Gene Symbol Ints5
Ensembl Gene ENSMUSG00000116347
Gene Name
Synonyms1110055N21Rik
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R0348 (G1)
Quality Score206
Status Not validated
Chromosome19
Chromosomal Location8888926-8895227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8895750 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 358 (L358F)
Ref Sequence ENSEMBL: ENSMUSP00000093968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246] [ENSMUST00000096249] [ENSMUST00000096251] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect probably benign
Transcript: ENSMUST00000096246
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096249
AA Change: L358F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652
AA Change: L358F

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096251
SMART Domains Protein: ENSMUSP00000093970
Gene: ENSMUSG00000071653

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187504
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188635
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex is a complex that associates with the C-terminal domain of RNA polymerase II large subunit. This complex is brought to U1 and U2 small nuclear RNA genes, where it is involved in the transcription and processing of their transcripts. The protein encoded by this gene represents a subunit of the Integrator complex. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Ctcf T A 8: 105,676,157 C560* probably null Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep1 T C 13: 42,158,379 V1365A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igf2bp1 T C 11: 95,968,893 N369S possibly damaging Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Liph C T 16: 21,967,980 probably null Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nfatc3 A G 8: 106,092,195 E515G probably damaging Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Olfm1 T A 2: 28,212,542 M76K probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Ints5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ints5 APN 19 8895487 missense possibly damaging 0.93
IGL01915:Ints5 APN 19 8896993 missense probably benign
IGL01993:Ints5 APN 19 8895465 missense probably benign
IGL02264:Ints5 APN 19 8895712 missense probably benign 0.02
IGL02367:Ints5 APN 19 8895595 missense probably benign 0.06
IGL02955:Ints5 APN 19 8897650 missense probably damaging 1.00
FR4449:Ints5 UTSW 19 8897230 missense probably benign 0.10
R0379:Ints5 UTSW 19 8897133 missense possibly damaging 0.90
R0617:Ints5 UTSW 19 8896019 missense probably damaging 1.00
R1954:Ints5 UTSW 19 8894896 missense probably damaging 1.00
R2172:Ints5 UTSW 19 8896282 missense possibly damaging 0.73
R2370:Ints5 UTSW 19 8896779 missense probably benign
R3116:Ints5 UTSW 19 8894772 missense possibly damaging 0.84
R4395:Ints5 UTSW 19 8896444 missense probably damaging 0.96
R5390:Ints5 UTSW 19 8896567 missense possibly damaging 0.73
R6868:Ints5 UTSW 19 8897386 missense probably damaging 1.00
R7133:Ints5 UTSW 19 8895559 missense probably damaging 1.00
X0066:Ints5 UTSW 19 8896231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTGCCTCAGTTGTAGGCATCC -3'
(R):5'- GCCGTAATGTCTCTCCACACAGTTC -3'

Sequencing Primer
(F):5'- TAGGGCACCTGGCTTCC -3'
(R):5'- CCAGGCCCTGGGTAGTAATAAC -3'
Posted On2013-05-09