Incidental Mutation 'R0409:4933417A18Rik'
ID36536
Institutional Source Beutler Lab
Gene Symbol 4933417A18Rik
Ensembl Gene ENSMUSG00000021415
Gene NameRIKEN cDNA 4933417A18 gene
Synonyms
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0409 (G1)
Quality Score107
Status Validated
Chromosome13
Chromosomal Location34924409-34955875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34924549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 5 (I5L)
Ref Sequence ENSEMBL: ENSMUSP00000125206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000160279] [ENSMUST00000160905] [ENSMUST00000223834]
Predicted Effect probably benign
Transcript: ENSMUST00000021851
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160279
AA Change: I5L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125324
Gene: ENSMUSG00000021415
AA Change: I5L

DomainStartEndE-ValueType
Pfam:DUF4523 34 199 1.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160905
AA Change: I5L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125206
Gene: ENSMUSG00000021415
AA Change: I5L

DomainStartEndE-ValueType
Pfam:DUF4523 34 199 9.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223834
Meta Mutation Damage Score 0.1572 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in 4933417A18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:4933417A18Rik APN 13 34924533 unclassified probably null
IGL02726:4933417A18Rik APN 13 34952960 intron probably benign
IGL03241:4933417A18Rik APN 13 34944330 missense probably damaging 0.98
R0324:4933417A18Rik UTSW 13 34924613 missense probably benign
R0394:4933417A18Rik UTSW 13 34932653 splice site probably benign
R1639:4933417A18Rik UTSW 13 34944250 missense possibly damaging 0.93
R1861:4933417A18Rik UTSW 13 34932507 missense possibly damaging 0.80
R2054:4933417A18Rik UTSW 13 34924591 missense probably damaging 0.99
R4625:4933417A18Rik UTSW 13 34932465 missense probably damaging 1.00
R4932:4933417A18Rik UTSW 13 34932630 missense possibly damaging 0.95
R5875:4933417A18Rik UTSW 13 34932446 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCTCAGGGTTCCAGGCCAATAC -3'
(R):5'- AGAGGAGGGTTCACATCACCATGC -3'

Sequencing Primer
(F):5'- AATACCTGGGCCATTGTGAC -3'
(R):5'- GTAAGCACTCTCCCTACATACATTTG -3'
Posted On2013-05-09