Incidental Mutation 'R4782:Col22a1'
ID366668
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Namecollagen, type XXII, alpha 1
SynonymsC80743, 2310067L16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4782 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location71795795-72034227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71801925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 981 (T981S)
Ref Sequence ENSEMBL: ENSMUSP00000155641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000229585]
Predicted Effect unknown
Transcript: ENSMUST00000159993
AA Change: T1536S
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: T1536S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000229585
AA Change: T981S
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,328,096 E3092G probably damaging Het
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Abtb2 A T 2: 103,717,299 D1006V probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ahnak A G 19: 9,012,499 probably benign Het
Akap6 CA C 12: 52,887,623 probably null Het
Amotl2 T G 9: 102,720,123 probably null Het
Ankrd34b T A 13: 92,438,305 I15N probably damaging Het
Ap3d1 C T 10: 80,721,586 probably null Het
Appl2 A T 10: 83,600,991 D635E probably damaging Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atp10a T C 7: 58,791,095 M496T probably benign Het
Atp2c2 A G 8: 119,749,152 K595E probably damaging Het
Atpaf2 T C 11: 60,404,412 H204R probably damaging Het
Atr G A 9: 95,862,797 V56I probably benign Het
Bod1l G A 5: 41,833,663 T183I probably benign Het
Btbd11 A C 10: 85,654,550 I1027L probably damaging Het
Ccdc171 A T 4: 83,681,016 E689D probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Col4a3bp T C 13: 96,612,265 V281A probably benign Het
Cpox G A 16: 58,672,623 A207T probably damaging Het
Cym G A 3: 107,216,097 T160I possibly damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddx4 C T 13: 112,613,696 probably null Het
Ddx4 A T 13: 112,651,360 V15E probably benign Het
Depdc1a G A 3: 159,526,636 E675K probably damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Dlg4 C T 11: 70,026,954 P21L probably damaging Het
Dmxl1 A T 18: 49,862,992 N395I probably damaging Het
Dzank1 A T 2: 144,504,399 C249S probably damaging Het
Efnb2 A T 8: 8,623,104 probably null Het
Ercc6l2 T G 13: 63,834,738 I244S probably damaging Het
Ewsr1 A T 11: 5,070,423 M584K unknown Het
Fam193b A G 13: 55,543,471 S197P probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo31 A T 8: 121,552,439 Y436* probably null Het
Fbxo31 A G 8: 121,552,441 Y436H probably damaging Het
Fcna T A 2: 25,625,326 D215V probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gcnt4 A T 13: 96,947,406 L403F possibly damaging Het
Gdf10 A G 14: 33,931,913 T126A probably benign Het
Ggcx A G 6: 72,428,892 K569E probably benign Het
Gm10250 C T 15: 5,121,096 probably benign Het
Gm8251 T C 1: 44,059,043 D965G possibly damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Ifi44 G A 3: 151,745,592 P241S probably damaging Het
Irs1 T C 1: 82,287,463 T1011A probably benign Het
Jag2 A T 12: 112,914,249 S595T probably benign Het
Kif5a T A 10: 127,230,954 Q960L probably benign Het
Kifc2 A G 15: 76,664,348 E430G possibly damaging Het
Lama3 T A 18: 12,411,570 C323* probably null Het
Lgsn T C 1: 31,203,742 Y302H probably benign Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrpap1 A G 5: 35,099,278 V120A probably damaging Het
Macrod2 T A 2: 140,419,938 D46E possibly damaging Het
Mbd4 C A 6: 115,845,322 R63L possibly damaging Het
Mfsd10 T C 5: 34,634,949 probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Ngb G A 12: 87,100,225 H73Y probably benign Het
Npepps G A 11: 97,226,826 T549I probably damaging Het
Nr1h2 A G 7: 44,550,499 V329A possibly damaging Het
Nsun6 T C 2: 15,036,326 I151M possibly damaging Het
Ofcc1 T C 13: 40,001,892 probably null Het
Olfr1388 T A 11: 49,443,869 F6Y probably benign Het
Olfr262 C T 19: 12,241,572 V30I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr391-ps C T 11: 73,798,839 C306Y probably benign Het
Olfr555 T A 7: 102,658,834 N4K possibly damaging Het
Olfr910 A G 9: 38,539,075 Y60C probably damaging Het
Parp6 A G 9: 59,634,984 probably null Het
Pcnt C A 10: 76,409,577 R1075S possibly damaging Het
Pla2g4f T C 2: 120,303,276 E548G probably damaging Het
Polrmt G T 10: 79,739,523 H725N probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Prtn3 C A 10: 79,882,065 P169H probably damaging Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprh A T 7: 4,569,577 H467Q probably benign Het
Raph1 A T 1: 60,489,114 I996N probably damaging Het
Rasa4 G A 5: 136,091,229 W53* probably null Het
Rasgrp1 C T 2: 117,284,875 R744Q probably benign Het
Rmnd5a T C 6: 71,413,349 E141G probably damaging Het
Rps12 T C 10: 23,786,790 I51M possibly damaging Het
Scn10a T G 9: 119,622,910 S1316R possibly damaging Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Setx G A 2: 29,144,046 R332Q probably damaging Het
Siglec1 A C 2: 131,075,923 S1011R probably damaging Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Slc11a1 T G 1: 74,384,088 L366R probably damaging Het
Slc12a1 C T 2: 125,161,079 R177* probably null Het
Slc30a1 A C 1: 191,909,048 K269Q probably benign Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Slf2 T A 19: 44,934,925 probably null Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spta1 A T 1: 174,230,666 Q1900L probably benign Het
Srgn C T 10: 62,497,852 E49K possibly damaging Het
Ssu2 A C 6: 112,376,450 C238G probably damaging Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Thra G A 11: 98,756,164 S37N probably benign Het
Toporsl A G 4: 52,610,845 D246G probably damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Usp10 A G 8: 119,941,191 Y77C probably benign Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r204 T G 13: 22,556,697 F166C probably benign Het
Vmn2r14 T C 5: 109,221,504 I68V probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Wsb1 A G 11: 79,240,373 M399T probably benign Het
Xbp1 C T 11: 5,521,167 T58M probably damaging Het
Zbtb46 A T 2: 181,391,136 D577E probably benign Het
Zfp366 A G 13: 99,246,483 D718G probably damaging Het
Zfp408 A T 2: 91,645,024 V595E possibly damaging Het
Zfp493 T A 13: 67,786,203 W60R probably null Het
Zfp606 A T 7: 12,494,005 K626N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 intron probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTAGAAGGTATGCCTCATGGGAC -3'
(R):5'- TAAGGAGTATGTGTGAACAGCCTG -3'

Sequencing Primer
(F):5'- CTGCCTCCATGGTTGAT -3'
(R):5'- AACAGCCTGGTGTGTGTGTAC -3'
Posted On2015-12-29