Incidental Mutation 'R3940:Col22a1'
ID307420
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Namecollagen, type XXII, alpha 1
SynonymsC80743, 2310067L16Rik
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location71795795-72034227 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71981933 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 260 (L260*)
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993]
Predicted Effect probably null
Transcript: ENSMUST00000159993
AA Change: L260*
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: L260*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 intron probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGCACCACGAAGTATGCTAC -3'
(R):5'- ATGACTCATAGCTTGGCTGC -3'

Sequencing Primer
(F):5'- ACGAAGTATGCTACCATTAGCTCAG -3'
(R):5'- GACTCATAGCTTGGCTGCTCTTG -3'
Posted On2015-04-17