Incidental Mutation 'R4786:Lef1'
ID367062
Institutional Source Beutler Lab
Gene Symbol Lef1
Ensembl Gene ENSMUSG00000027985
Gene Namelymphoid enhancer binding factor 1
Synonymslymphoid enhancer factor 1, Lef-1
MMRRC Submission 041995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4786 (G1)
Quality Score192
Status Not validated
Chromosome3
Chromosomal Location131110471-131224356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131111524 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 18 (T18I)
Ref Sequence ENSEMBL: ENSMUSP00000101948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029611] [ENSMUST00000066849] [ENSMUST00000098611] [ENSMUST00000106341]
Predicted Effect probably damaging
Transcript: ENSMUST00000029611
AA Change: T18I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029611
Gene: ENSMUSG00000027985
AA Change: T18I

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 5e-88 PFAM
low complexity region 245 259 N/A INTRINSIC
HMG 296 366 7.68e-23 SMART
low complexity region 372 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066849
AA Change: T18I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067808
Gene: ENSMUSG00000027985
AA Change: T18I

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098611
SMART Domains Protein: ENSMUSP00000096211
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 145 2.8e-54 PFAM
low complexity region 179 193 N/A INTRINSIC
HMG 230 300 7.68e-23 SMART
low complexity region 306 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106341
AA Change: T18I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101948
Gene: ENSMUSG00000027985
AA Change: T18I

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1.3e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200166
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele are small and die postnatally showing lack of teeth, mammary and uterine glands, whiskers, body hair, dermal-associated fat, and a dentate gyrus, as well as defects in hippocampus morphology, hair follicle development, retinal vasculature, and vascular regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,536 I134N possibly damaging Het
Acvr1c T C 2: 58,280,354 Y414C probably damaging Het
Adam32 A C 8: 24,863,493 S693R probably damaging Het
Aldh2 A T 5: 121,572,824 F314Y probably benign Het
Anks1 A G 17: 28,052,730 D874G possibly damaging Het
Ap4b1 T A 3: 103,818,804 V372E probably benign Het
Aqp12 G A 1: 93,006,455 C18Y probably damaging Het
Arap1 T A 7: 101,385,005 I218N possibly damaging Het
Arhgap42 C A 9: 9,238,698 E28* probably null Het
Asb5 G A 8: 54,585,839 E247K probably benign Het
Atg9b T C 5: 24,386,089 D781G possibly damaging Het
Atxn10 A G 15: 85,387,143 H294R probably benign Het
Bod1l G T 5: 41,819,438 T1511K probably benign Het
Btnl2 A T 17: 34,363,348 N296I probably damaging Het
Camta1 A T 4: 151,290,039 L168H probably damaging Het
Cant1 A T 11: 118,408,839 V265E possibly damaging Het
Ccdc157 T C 11: 4,151,861 D20G probably damaging Het
Cd209c T G 8: 3,945,698 T35P possibly damaging Het
Cdc20b G A 13: 113,078,734 V279M probably damaging Het
Cdh18 T A 15: 23,410,787 W453R probably null Het
Cdh24 A G 14: 54,637,550 S333P possibly damaging Het
Ceacam11 T C 7: 17,972,314 probably null Het
Ciz1 C T 2: 32,377,527 P150L probably damaging Het
Crip3 C A 17: 46,431,042 Q152K possibly damaging Het
Dars2 G A 1: 161,060,760 R197W probably damaging Het
Dctn4 A G 18: 60,555,195 D394G probably damaging Het
Dido1 T C 2: 180,670,871 Y1077C possibly damaging Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egln3 A T 12: 54,185,581 I146N probably damaging Het
Eif2ak3 C T 6: 70,892,618 T763M possibly damaging Het
Etfbkmt A T 6: 149,147,246 M1L probably benign Het
Fam171a1 A T 2: 3,225,578 I583F probably damaging Het
Fbxo38 A C 18: 62,529,674 L249W probably damaging Het
Fxyd5 T C 7: 31,041,482 probably benign Het
Gabrr3 C A 16: 59,430,100 T154K probably benign Het
Gm7233 C A 14: 43,180,890 D90E probably benign Het
Gm8186 A G 17: 26,099,040 V61A probably benign Het
Gm9573 A T 17: 35,619,329 probably benign Het
Gnao1 A G 8: 93,944,303 I137V probably benign Het
Gnptab A G 10: 88,436,182 M945V probably damaging Het
Gpsm1 G A 2: 26,322,481 A78T probably benign Het
Gtf2b T C 3: 142,781,469 L222P probably damaging Het
Hnrnpf A G 6: 117,923,896 Y47C probably damaging Het
Itga6 A G 2: 71,838,690 N608S possibly damaging Het
Kdm2b T C 5: 122,880,854 probably null Het
Krit1 T A 5: 3,812,467 H207Q possibly damaging Het
Ky A G 9: 102,541,987 N398D probably benign Het
Lama1 T A 17: 67,773,859 V1294E possibly damaging Het
Lrp2 T C 2: 69,537,956 N178S probably damaging Het
Lrrc36 A G 8: 105,455,278 T525A probably benign Het
Map3k8 A T 18: 4,340,647 C222* probably null Het
Mapre2 G C 18: 23,877,959 S199T probably benign Het
Mcm3ap A G 10: 76,488,466 N911S probably benign Het
Mroh4 G T 15: 74,610,234 H722Q probably benign Het
Myo5b A C 18: 74,695,380 Y701S probably benign Het
Myt1l G T 12: 29,811,458 V80L unknown Het
Ncoa7 C A 10: 30,655,642 V24L probably benign Het
Nlrp10 A T 7: 108,925,238 V345D probably damaging Het
Nmral1 C A 16: 4,716,424 G51V probably damaging Het
Npc1 A G 18: 12,199,497 I797T probably benign Het
Olfr1269 A T 2: 90,119,007 I197N possibly damaging Het
Olfr936 T A 9: 39,047,487 R22* probably null Het
Olfr954 A T 9: 39,461,841 I134L probably benign Het
Pclo A T 5: 14,723,267 I4419F unknown Het
Phf3 C A 1: 30,816,557 E983* probably null Het
Pitpnm2 A T 5: 124,121,743 Y1149* probably null Het
Sdc3 A T 4: 130,822,768 T430S probably damaging Het
Sema3f A G 9: 107,682,682 V671A probably benign Het
Sigirr T G 7: 141,091,433 S379R probably benign Het
Slc25a23 T A 17: 57,047,326 N360I possibly damaging Het
Slco6c1 A T 1: 97,087,995 M357K probably benign Het
Sox14 C A 9: 99,874,965 M240I probably benign Het
Stradb A T 1: 58,991,208 probably benign Het
Szt2 A T 4: 118,399,062 M200K probably benign Het
Tef T C 15: 81,815,252 S85P probably benign Het
Thada T A 17: 84,458,855 H41L possibly damaging Het
Tinagl1 A G 4: 130,173,931 F90S probably benign Het
Tnfaip1 G A 11: 78,530,219 T5I possibly damaging Het
Tnfrsf23 A T 7: 143,680,064 V59D probably damaging Het
Tnpo3 A G 6: 29,578,542 V311A probably benign Het
Trak1 T A 9: 121,472,494 M772K probably benign Het
Ubash3a A G 17: 31,217,964 D185G probably benign Het
Vmn2r120 T C 17: 57,522,048 T516A probably benign Het
Wdr4 A C 17: 31,509,811 L130R probably damaging Het
Zfp12 T C 5: 143,245,502 I528T probably damaging Het
Zfp607a T C 7: 27,879,413 L636P probably damaging Het
Other mutations in Lef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Lef1 APN 3 131113850 splice site probably benign
IGL00515:Lef1 APN 3 131204277 missense probably damaging 1.00
IGL00780:Lef1 APN 3 131193130 missense possibly damaging 0.69
IGL02057:Lef1 APN 3 131200402 nonsense probably null
IGL02556:Lef1 APN 3 131194793 splice site probably null
IGL02804:Lef1 APN 3 131194689 missense probably damaging 1.00
IGL03143:Lef1 APN 3 131200316 nonsense probably null
IGL03169:Lef1 APN 3 131194663 missense probably damaging 1.00
R0470:Lef1 UTSW 3 131112826 intron probably benign
R1354:Lef1 UTSW 3 131194668 missense probably damaging 1.00
R1677:Lef1 UTSW 3 131200289 splice site probably benign
R1860:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R2013:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R2015:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R3440:Lef1 UTSW 3 131184758 missense probably damaging 1.00
R3736:Lef1 UTSW 3 131191066 missense possibly damaging 0.51
R3918:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R4052:Lef1 UTSW 3 131194689 missense probably damaging 1.00
R4346:Lef1 UTSW 3 131194708 missense probably damaging 1.00
R4608:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4764:Lef1 UTSW 3 131184733 missense probably benign 0.00
R5298:Lef1 UTSW 3 131194667 missense possibly damaging 0.80
R5394:Lef1 UTSW 3 131194659 missense probably damaging 1.00
R6827:Lef1 UTSW 3 131200404 critical splice donor site probably null
R6893:Lef1 UTSW 3 131115500 missense possibly damaging 0.77
R6974:Lef1 UTSW 3 131111574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTAAGTGGGAAAGCGC -3'
(R):5'- ATGGACTAGGGGCCGTTATTCC -3'

Sequencing Primer
(F):5'- CAATCGCAGAGGCTCCTG -3'
(R):5'- TCAATGGCCACCGTGGTC -3'
Posted On2015-12-29