Incidental Mutation 'R4770:Gm13084'
ID367396
Institutional Source Beutler Lab
Gene Symbol Gm13084
Ensembl Gene ENSMUSG00000059218
Gene Namepredicted gene 13084
Synonyms
MMRRC Submission 042410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4770 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143809245-143816093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143811949 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 151 (E151K)
Ref Sequence ENSEMBL: ENSMUSP00000101395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
Predicted Effect probably benign
Transcript: ENSMUST00000075045
AA Change: E151K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: E151K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105769
AA Change: E151K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218
AA Change: E151K

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137635
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,071,515 V503A possibly damaging Het
Agps T A 2: 75,891,855 F463Y possibly damaging Het
Amigo3 A T 9: 108,053,535 L52F probably damaging Het
Anapc1 T C 2: 128,686,060 probably benign Het
Ankrd36 G T 11: 5,590,870 C312F possibly damaging Het
Asic2 A C 11: 80,971,492 D226E probably benign Het
Atp8b2 T A 3: 89,957,067 Q197L probably damaging Het
C2cd3 A G 7: 100,443,435 Y495C probably damaging Het
Ccdc51 A G 9: 109,090,910 T125A probably benign Het
Ccser1 A G 6: 61,311,501 Y216C possibly damaging Het
Cntfr A T 4: 41,663,282 I175N possibly damaging Het
Cox10 G A 11: 63,964,163 R431W probably benign Het
Cubn T C 2: 13,314,767 T2881A possibly damaging Het
Cyp2d9 T A 15: 82,452,573 V41E probably damaging Het
Dmrtb1 C T 4: 107,683,789 G125D probably benign Het
Dscaml1 C T 9: 45,670,106 R408C probably damaging Het
Duox2 A T 2: 122,284,916 S1052T probably benign Het
Ecm1 A G 3: 95,737,961 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Epb41l1 T A 2: 156,529,424 M727K probably benign Het
Exosc9 T C 3: 36,553,835 V64A probably damaging Het
Ezh2 A T 6: 47,540,696 I564N probably damaging Het
Fam160b2 T A 14: 70,588,287 D351V probably damaging Het
Fam89b C A 19: 5,729,454 R25L probably damaging Het
Fgr C T 4: 132,987,291 T98M probably damaging Het
Gapvd1 A G 2: 34,691,181 S1089P probably damaging Het
Gbp5 A T 3: 142,508,076 I544F possibly damaging Het
Gli2 C A 1: 118,982,588 probably benign Het
Gm9934 A G 7: 93,052,984 noncoding transcript Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Greb1 A T 12: 16,681,356 D1660E probably benign Het
Gtf2i T A 5: 134,243,560 N750I possibly damaging Het
H2-DMb2 G C 17: 34,148,724 D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Itga2b A G 11: 102,460,756 F581S probably damaging Het
Itsn2 T A 12: 4,627,892 M83K probably damaging Het
Kif27 G A 13: 58,344,377 T316M probably damaging Het
Lad1 A T 1: 135,825,793 Q26L probably damaging Het
Lrrn3 T A 12: 41,452,443 H625L probably benign Het
Mast1 A G 8: 84,929,246 V155A probably benign Het
Mast3 G A 8: 70,786,220 T480M probably damaging Het
Mpc1 C T 17: 8,293,545 probably benign Het
Mycbp2 T A 14: 103,219,944 M1606L probably benign Het
Myo1c T A 11: 75,660,313 L238* probably null Het
Nanog T G 6: 122,711,591 S44A possibly damaging Het
Neb T C 2: 52,149,153 Q6958R probably benign Het
Ngef C T 1: 87,477,561 R709H probably damaging Het
Nr1d1 A G 11: 98,770,645 V265A probably benign Het
Nr3c2 A G 8: 76,908,243 probably null Het
Odf3b A G 15: 89,379,123 I19T probably damaging Het
Olfm5 A G 7: 104,160,478 S164P probably benign Het
Parvb T C 15: 84,303,905 probably null Het
Pde4dip G T 3: 97,767,084 A172D probably damaging Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Pik3r6 T A 11: 68,529,894 V155E probably damaging Het
Pinx1 T G 14: 63,872,371 V124G probably damaging Het
Poglut1 A G 16: 38,534,757 Y236H probably damaging Het
Pou4f2 T A 8: 78,436,401 M2L unknown Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkaca A G 8: 83,990,870 N209S probably benign Het
Ring1 G A 17: 34,023,387 P49S probably damaging Het
Rnf20 T A 4: 49,633,412 probably null Het
Rnf25 G A 1: 74,593,940 R418C probably damaging Het
Ryr1 G T 7: 29,109,282 P462Q probably damaging Het
Serpinb3d A G 1: 107,078,278 F360S probably damaging Het
Setd7 T C 3: 51,521,422 E329G probably damaging Het
Slco2b1 C T 7: 99,670,949 probably null Het
Snap91 G A 9: 86,773,601 T844I possibly damaging Het
Snhg5 C T 9: 88,522,371 noncoding transcript Het
Son T A 16: 91,658,868 V1501E probably damaging Het
Syncrip T A 9: 88,479,852 E70V probably damaging Het
Tas2r125 A G 6: 132,909,787 D46G probably damaging Het
Tmem115 G A 9: 107,534,957 R160Q probably benign Het
Trerf1 G A 17: 47,319,655 noncoding transcript Het
Uggt2 A T 14: 119,029,054 probably null Het
Ush2a G T 1: 188,549,879 V1864F probably benign Het
Xkr4 A T 1: 3,216,491 V492D probably damaging Het
Zcchc6 A G 13: 59,772,884 probably benign Het
Zfp646 T A 7: 127,883,477 S1609T possibly damaging Het
Zfp65 A T 13: 67,708,358 H277Q probably damaging Het
Zfp69 A G 4: 120,934,417 S176P probably damaging Het
Zfp747 C T 7: 127,375,799 A10T probably damaging Het
Zfp850 T C 7: 27,984,986 probably null Het
Other mutations in Gm13084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Gm13084 APN 4 143812723 missense probably benign 0.32
IGL01075:Gm13084 APN 4 143811646 missense possibly damaging 0.47
IGL02705:Gm13084 APN 4 143810802 missense probably damaging 1.00
IGL03011:Gm13084 APN 4 143811760 missense possibly damaging 0.95
PIT4498001:Gm13084 UTSW 4 143812836 missense possibly damaging 0.63
R0268:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0344:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0390:Gm13084 UTSW 4 143811699 missense probably benign 0.09
R0597:Gm13084 UTSW 4 143812652 missense probably damaging 0.98
R0646:Gm13084 UTSW 4 143812585 missense possibly damaging 0.83
R0927:Gm13084 UTSW 4 143812808 missense probably benign 0.05
R0973:Gm13084 UTSW 4 143811858 missense probably damaging 1.00
R1851:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R1852:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R3699:Gm13084 UTSW 4 143810352 missense probably benign 0.05
R3705:Gm13084 UTSW 4 143811775 missense probably benign 0.06
R3845:Gm13084 UTSW 4 143811975 missense probably damaging 0.96
R4035:Gm13084 UTSW 4 143810456 missense probably benign 0.08
R4044:Gm13084 UTSW 4 143811600 missense probably benign 0.34
R4439:Gm13084 UTSW 4 143811573 missense possibly damaging 0.49
R4660:Gm13084 UTSW 4 143811865 missense probably benign 0.19
R4838:Gm13084 UTSW 4 143810805 nonsense probably null
R5534:Gm13084 UTSW 4 143812599 nonsense probably null
R5691:Gm13084 UTSW 4 143812009 missense probably benign 0.44
R5893:Gm13084 UTSW 4 143810468 missense probably damaging 1.00
R6123:Gm13084 UTSW 4 143812764 missense possibly damaging 0.89
R6285:Gm13084 UTSW 4 143816039 missense probably damaging 1.00
R6886:Gm13084 UTSW 4 143812762 missense probably benign 0.29
R7105:Gm13084 UTSW 4 143810771 missense probably benign 0.04
R7135:Gm13084 UTSW 4 143810663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTTCTATGACTGTGGCTTTGG -3'
(R):5'- TGGTTTCATTCTAGGCACAGG -3'

Sequencing Primer
(F):5'- GGTTAAGCCATAAATTTTCAGCTTTC -3'
(R):5'- TCATTCTAGGCACAGGAATAAGC -3'
Posted On2015-12-29