Incidental Mutation 'R4778:Pstpip1'
ID368091
Institutional Source Beutler Lab
Gene Symbol Pstpip1
Ensembl Gene ENSMUSG00000032322
Gene Nameproline-serine-threonine phosphatase-interacting protein 1
Synonymsdef-2, CD2BP1
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56089962-56128888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56128620 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 383 (D383G)
Ref Sequence ENSEMBL: ENSMUSP00000055823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059206
AA Change: D383G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055823
Gene: ENSMUSG00000032322
AA Change: D383G

DomainStartEndE-ValueType
FCH 12 98 7.03e-29 SMART
Blast:SH3 226 248 1e-7 BLAST
low complexity region 318 337 N/A INTRINSIC
SH3 361 415 8.24e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214970
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is highly expressed in hemopoietic tissues. This protein functions via its interaction with several different proteins involved in cytoskeletal organization and inflammatory processes. It binds to the cytoplasmic tail of CD2, an effector of T cell activation and adhesion, downregulating CD2-triggered adhesion. It binds PEST-type protein tyrosine phosphatases (PTP) and directs them to c-Abl kinase to mediate c-Abl dephosphorylation, thereby, regulating c-Abl activity. It also interacts with pyrin, which is found in association with the cytoskeleton in myeloid/monocytic cells and modulates immunoregulatory functions. Mutations in this gene are associated with PAPA (pyogenic sterile arthritis, pyoderma gangrenosum, and acne) syndrome. It is hypothesized that the disease-causing mutations compromise physiologic signaling necessary for the maintenance of a proper inflammatory response. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in immune cells with T cell hyperresponsive to antigen receptor stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Pstpip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03103:Pstpip1 APN 9 56114308 missense possibly damaging 0.65
R0108:Pstpip1 UTSW 9 56127766 missense probably benign 0.00
R0344:Pstpip1 UTSW 9 56126645 missense probably benign
R1269:Pstpip1 UTSW 9 56114306 missense probably damaging 1.00
R1743:Pstpip1 UTSW 9 56125930 missense probably damaging 1.00
R4648:Pstpip1 UTSW 9 56125218 missense probably damaging 1.00
R5932:Pstpip1 UTSW 9 56125930 missense probably damaging 1.00
R7107:Pstpip1 UTSW 9 56128650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAGGCCTTAGCATGAC -3'
(R):5'- TATTGAGAGTAGCCAGCACCCAG -3'

Sequencing Primer
(F):5'- TTAGCATGACTCAGCAGACTG -3'
(R):5'- ACCACCGGGCTTGGTTCTG -3'
Posted On2015-12-29