Incidental Mutation 'R4858:Baz2b'
ID372204
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59907743 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1741 (M1741L)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect probably benign
Transcript: ENSMUST00000090925
AA Change: M1741L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: M1741L

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
AA Change: M1741L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: M1741L

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130637
AA Change: M101L
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987
AA Change: M101L

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 unclassified probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 intron probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCCTGGTTACAGCTATATC -3'
(R):5'- TCCTTTGCTGGAAGTCATCAC -3'

Sequencing Primer
(F):5'- CAGCCTGGTTACAGCTATATCTAGGG -3'
(R):5'- GCTGGAAGTCATCACTAATGTCAC -3'
Posted On2016-03-01