Incidental Mutation 'R0498:Baz2b'
ID40581
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R0498 (G1)
Quality Score151
Status Validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 59901996 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect probably benign
Transcript: ENSMUST00000090925
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 unclassified probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 intron probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGTACGAGTTTCAAGTTCACAGG -3'
(R):5'- AGTTCTAACTGCCAAAGGTGCAGC -3'

Sequencing Primer
(F):5'- GTACCTAGACCTTGGAACGG -3'
(R):5'- AAGATAGCTTTTTCTCATGCTTTACC -3'
Posted On2013-05-23