Incidental Mutation 'R4829:Mtnr1a'
ID372672
Institutional Source Beutler Lab
Gene Symbol Mtnr1a
Ensembl Gene ENSMUSG00000054764
Gene Namemelatonin receptor 1A
SynonymsMelR, Mel1a receptor
MMRRC Submission 042445-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4829 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45069137-45088506 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 45085615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067984]
Predicted Effect probably benign
Transcript: ENSMUST00000067984
SMART Domains Protein: ENSMUSP00000069872
Gene: ENSMUSG00000054764

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 315 1.8e-11 PFAM
Pfam:7TM_GPCR_Srsx 41 313 2.5e-10 PFAM
Pfam:7tm_1 47 298 5.6e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130141
AA Change: V30A
SMART Domains Protein: ENSMUSP00000115764
Gene: ENSMUSG00000054764
AA Change: V30A

DomainStartEndE-ValueType
Pfam:7tm_1 23 92 6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209488
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal, with normal circadian functions. In vitro studies report the absence of inhibitory effects of melatonin on suprachiasma neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,019 V1323A probably damaging Het
1700029J07Rik T C 8: 45,967,915 I159V probably damaging Het
1700061G19Rik A G 17: 56,883,500 probably null Het
Abcb1a T C 5: 8,723,214 L814P probably damaging Het
Acat1 C A 9: 53,591,456 G191V probably damaging Het
Adamts20 A T 15: 94,326,396 D1184E probably benign Het
Adssl1 T C 12: 112,634,713 L283P probably damaging Het
Arid4a A G 12: 71,023,498 probably null Het
Arid4b T A 13: 14,184,438 D599E probably benign Het
AW146154 T C 7: 41,480,633 K353R possibly damaging Het
Axdnd1 G T 1: 156,376,646 R547S possibly damaging Het
BC067074 A G 13: 113,368,162 I1942V probably benign Het
BC147527 G A 13: 120,308,390 C82Y possibly damaging Het
Bcat1 A T 6: 145,015,475 F134Y probably damaging Het
Camk2d C A 3: 126,779,997 probably benign Het
Catsperg2 T G 7: 29,701,125 K268T probably damaging Het
Ccar1 A C 10: 62,745,335 F1103L unknown Het
Ccdc141 T A 2: 77,074,916 E395D probably damaging Het
Cdc37l1 A G 19: 28,990,583 T16A probably benign Het
Cdca2 T A 14: 67,693,753 probably null Het
Cntn5 T G 9: 9,976,283 K219Q probably damaging Het
Col23a1 C A 11: 51,557,586 A202E unknown Het
Csmd1 G A 8: 16,127,296 L1318F probably damaging Het
Csnk1g3 C T 18: 53,895,823 A16V possibly damaging Het
Dab2 A G 15: 6,424,681 D224G probably damaging Het
Ddr1 A T 17: 35,685,113 C625S probably damaging Het
Dennd4a T C 9: 64,889,056 V788A probably damaging Het
Dgcr2 T C 16: 17,842,753 E402G possibly damaging Het
Dhcr7 T G 7: 143,837,917 I81S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fat1 C T 8: 45,036,162 T3467I probably damaging Het
Fblim1 T C 4: 141,584,709 E235G probably damaging Het
Fbxo38 T A 18: 62,518,591 M548L probably benign Het
Fstl5 T C 3: 76,322,182 Y97H probably damaging Het
Glb1l A T 1: 75,200,350 S481T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gp2 A T 7: 119,457,184 V22E possibly damaging Het
Grin1 A G 2: 25,318,724 S55P possibly damaging Het
Herc2 A G 7: 56,106,492 D760G probably benign Het
Hpn A G 7: 31,098,875 probably benign Het
Hsf2 T C 10: 57,496,170 V73A probably damaging Het
Ighv1-42 T C 12: 114,937,168 Y80C probably benign Het
Ighv1-64 T C 12: 115,507,726 K57R probably benign Het
Klc1 T C 12: 111,795,603 I569T probably damaging Het
Klra3 T G 6: 130,323,616 K263N probably benign Het
Lrcol1 C A 5: 110,354,527 H90N probably benign Het
Mamdc4 T C 2: 25,565,356 E921G possibly damaging Het
Mark1 G A 1: 184,905,527 R622W possibly damaging Het
Mdga1 A G 17: 29,846,369 S696P possibly damaging Het
Mmp1b C T 9: 7,370,729 probably null Het
Myo5a T C 9: 75,136,407 I226T probably damaging Het
Ncoa6 G T 2: 155,415,227 P799T probably damaging Het
Npc1l1 C T 11: 6,214,010 probably null Het
Nxph3 T C 11: 95,511,495 E31G probably benign Het
Obscn T C 11: 59,054,246 I4649V probably null Het
Olfr1100 G A 2: 86,978,574 S74L probably damaging Het
Olfr875 G T 9: 37,772,947 C96F probably damaging Het
Olfr955 A T 9: 39,470,367 Y120N probably damaging Het
Olfr960 A T 9: 39,623,438 H103L probably damaging Het
P3h3 G A 6: 124,841,638 probably benign Het
Pcnx2 A T 8: 125,861,058 probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pla2g4d A G 2: 120,266,743 S792P probably damaging Het
Plppr4 A T 3: 117,335,591 L76M possibly damaging Het
Ppp2r3a A T 9: 101,212,510 S205T possibly damaging Het
Prkdc G A 16: 15,702,075 D1126N possibly damaging Het
Prrt4 G A 6: 29,177,182 S196L probably benign Het
Ptpn21 A C 12: 98,689,296 S471A probably damaging Het
Ptprk C A 10: 28,580,484 S9* probably null Het
Rassf4 A T 6: 116,645,142 I163K possibly damaging Het
Rgs22 C A 15: 36,103,888 R142S probably damaging Het
Rit2 C A 18: 31,212,673 L73F probably damaging Het
Rrbp1 A C 2: 143,989,687 S187A probably benign Het
Rspo2 A T 15: 43,093,187 Y83* probably null Het
Scn5a C T 9: 119,534,707 V456M probably benign Het
Scn9a T A 2: 66,551,713 H290L probably benign Het
Smarca4 T C 9: 21,639,327 I452T probably damaging Het
Smc2 T A 4: 52,449,612 I198K probably damaging Het
Smim14 G A 5: 65,460,603 probably benign Het
Spg11 A C 2: 122,108,455 N339K probably benign Het
Spta1 A G 1: 174,237,927 E2014G probably benign Het
Stk4 T C 2: 164,099,827 probably null Het
Sypl C T 12: 32,967,646 T121M probably damaging Het
Tas2r120 T A 6: 132,657,368 F138I probably benign Het
Tet2 A C 3: 133,476,620 C1194W possibly damaging Het
Tex29 T C 8: 11,855,668 probably benign Het
Tnfrsf22 T A 7: 143,643,330 T91S possibly damaging Het
Tnik A T 3: 28,539,541 probably benign Het
Tnr A T 1: 159,858,404 I402F probably benign Het
Unc93b1 A T 19: 3,944,293 S475C probably damaging Het
Utrn T A 10: 12,663,461 E1937D probably benign Het
Vmn1r227 A T 17: 20,735,665 noncoding transcript Het
Vmn2r101 G A 17: 19,611,967 V742I probably benign Het
Vmn2r81 T C 10: 79,247,801 L3P possibly damaging Het
Zfp882 T G 8: 71,914,389 H353Q probably damaging Het
Other mutations in Mtnr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mtnr1a APN 8 45069382 missense probably damaging 0.97
IGL03230:Mtnr1a APN 8 45087398 missense probably damaging 1.00
R0149:Mtnr1a UTSW 8 45069315 missense probably benign
R0744:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0833:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0836:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0856:Mtnr1a UTSW 8 45087833 missense possibly damaging 0.86
R1445:Mtnr1a UTSW 8 45087745 missense probably benign 0.27
R1983:Mtnr1a UTSW 8 45087434 missense probably benign 0.01
R2444:Mtnr1a UTSW 8 45087658 nonsense probably null
R2884:Mtnr1a UTSW 8 45087268 missense probably benign 0.00
R3947:Mtnr1a UTSW 8 45087520 missense probably damaging 1.00
R5681:Mtnr1a UTSW 8 45087937 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTTGTGTGTCAAGCATTTTACCAAG -3'
(R):5'- TAAATGGCTCCTCAACCCAGTTTTG -3'

Sequencing Primer
(F):5'- CAAGGAGCCATTATGCTAGCCTATG -3'
(R):5'- TTTTCAAAAGGCATCCAAAGCAGG -3'
Posted On2016-03-01