Incidental Mutation 'R4851:Dclk1'
ID373528
Institutional Source Beutler Lab
Gene Symbol Dclk1
Ensembl Gene ENSMUSG00000027797
Gene Namedoublecortin-like kinase 1
Synonyms2810480F11Rik, Dcamkl1, CPG16, Click-I, Dcl, DCLK, 1700113D08Rik
MMRRC Submission 042463-MU
Accession Numbers

Genbank: NM_019978; MGI: 1330861

Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R4851 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location55242364-55539068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55480390 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 86 (G86R)
Ref Sequence ENSEMBL: ENSMUSP00000142840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054237] [ENSMUST00000070418] [ENSMUST00000196745] [ENSMUST00000198412] [ENSMUST00000198437] [ENSMUST00000199169] [ENSMUST00000199702] [ENSMUST00000200352]
Predicted Effect probably damaging
Transcript: ENSMUST00000054237
AA Change: G409R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050034
Gene: ENSMUSG00000027797
AA Change: G409R

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
S_TKc 406 663 1.71e-104 SMART
low complexity region 736 747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070418
AA Change: G86R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070292
Gene: ENSMUSG00000027797
AA Change: G86R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 1.71e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196745
AA Change: G393R

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143659
Gene: ENSMUSG00000027797
AA Change: G393R

DomainStartEndE-ValueType
DCX 52 143 7.3e-46 SMART
DCX 181 269 1.2e-37 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
S_TKc 390 646 8.3e-107 SMART
low complexity region 719 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197870
Predicted Effect possibly damaging
Transcript: ENSMUST00000198412
AA Change: G86R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142637
Gene: ENSMUSG00000027797
AA Change: G86R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 339 8.1e-107 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198437
AA Change: G102R

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143016
Gene: ENSMUSG00000027797
AA Change: G102R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 99 356 1.71e-104 SMART
low complexity region 429 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198757
Predicted Effect probably damaging
Transcript: ENSMUST00000199169
AA Change: G86R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143563
Gene: ENSMUSG00000027797
AA Change: G86R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.5e-107 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199702
AA Change: G85R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143507
Gene: ENSMUSG00000027797
AA Change: G85R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 82 339 8.5e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200221
Predicted Effect probably damaging
Transcript: ENSMUST00000200352
AA Change: G86R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142840
Gene: ENSMUSG00000027797
AA Change: G86R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.3e-107 SMART
Meta Mutation Damage Score 0.43 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a null allele lack the corpus callosum and hippocampal commissure and show aberrant interhemispheric axonal projections. Mice homozygous for a different null allele have normal gross brain architecture but show axonal and dendritic defects following knockdown of Dcx expression. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A G 16: 4,976,274 noncoding transcript Het
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
App T C 16: 85,056,434 D252G unknown Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Dock10 A T 1: 80,549,157 S782T probably benign Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exoc4 T A 6: 33,918,408 C787S probably damaging Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hoxc5 T A 15: 103,015,369 I199N probably damaging Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhb22 A C 18: 37,519,034 D185A possibly damaging Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in Dclk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dclk1 APN 3 55247286 missense probably damaging 1.00
IGL02148:Dclk1 APN 3 55500099 missense probably damaging 1.00
IGL02901:Dclk1 APN 3 55487787 splice site probably benign
IGL03086:Dclk1 APN 3 55247367 missense probably damaging 0.96
IGL03213:Dclk1 APN 3 55480384 nonsense probably null
R0037:Dclk1 UTSW 3 55256059 missense probably benign 0.02
R0316:Dclk1 UTSW 3 55502892 missense probably damaging 1.00
R0885:Dclk1 UTSW 3 55487307 missense probably damaging 1.00
R1211:Dclk1 UTSW 3 55380823 missense probably benign 0.05
R1234:Dclk1 UTSW 3 55489877 missense probably damaging 1.00
R1540:Dclk1 UTSW 3 55477823 missense probably damaging 1.00
R1928:Dclk1 UTSW 3 55247521 missense possibly damaging 0.48
R2081:Dclk1 UTSW 3 55521925 critical splice donor site probably null
R2152:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2153:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2213:Dclk1 UTSW 3 55480433 missense probably damaging 1.00
R3745:Dclk1 UTSW 3 55247442 missense possibly damaging 0.87
R3899:Dclk1 UTSW 3 55247329 missense probably damaging 0.99
R4569:Dclk1 UTSW 3 55247410 missense probably damaging 1.00
R4890:Dclk1 UTSW 3 55521932 missense probably benign
R5105:Dclk1 UTSW 3 55255939 missense probably benign 0.00
R5175:Dclk1 UTSW 3 55247227 missense possibly damaging 0.80
R5364:Dclk1 UTSW 3 55255945 missense possibly damaging 0.95
R5613:Dclk1 UTSW 3 55516939 missense probably benign 0.15
R5819:Dclk1 UTSW 3 55489864 missense probably damaging 0.98
R6113:Dclk1 UTSW 3 55489819 missense probably benign 0.00
R6162:Dclk1 UTSW 3 55256154 missense probably benign 0.02
R6190:Dclk1 UTSW 3 55487811 missense probably damaging 1.00
R6193:Dclk1 UTSW 3 55516871 critical splice acceptor site probably null
R6380:Dclk1 UTSW 3 55247194 missense probably damaging 1.00
R6406:Dclk1 UTSW 3 55480406 missense probably damaging 1.00
R6543:Dclk1 UTSW 3 55500131 missense probably damaging 1.00
R6745:Dclk1 UTSW 3 55477808 missense probably damaging 1.00
R6970:Dclk1 UTSW 3 55466601 intron probably benign
R7037:Dclk1 UTSW 3 55463048 missense probably damaging 1.00
R7086:Dclk1 UTSW 3 55487912 critical splice donor site probably null
R7163:Dclk1 UTSW 3 55256128 nonsense probably null
R7198:Dclk1 UTSW 3 55477875 missense possibly damaging 0.70
Z1088:Dclk1 UTSW 3 55500105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGAGTCAGTCTGAGCCTGC -3'
(R):5'- AAAGTCTGTCCTTAGGTGGC -3'

Sequencing Primer
(F):5'- TCTGAGCCTGCCAGGGAG -3'
(R):5'- AAAGTCTGTCCTTAGGTGGCTTTTC -3'
Posted On2016-03-01