Incidental Mutation 'R4984:Gpr89'
ID385781
Institutional Source Beutler Lab
Gene Symbol Gpr89
Ensembl Gene ENSMUSG00000028096
Gene NameG protein-coupled receptor 89
Synonyms4933412D19Rik, SH120
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4984 (G1)
Quality Score158
Status Validated
Chromosome3
Chromosomal Location96868281-96905346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96905196 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 10 (M10L)
Ref Sequence ENSEMBL: ENSMUSP00000116016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029738] [ENSMUST00000154750] [ENSMUST00000199597]
Predicted Effect probably benign
Transcript: ENSMUST00000029738
AA Change: M10L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029738
Gene: ENSMUSG00000028096
AA Change: M10L

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
Pfam:GPHR_N 140 207 1.1e-31 PFAM
Pfam:ABA_GPCR 276 446 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154750
AA Change: M10L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116016
Gene: ENSMUSG00000028096
AA Change: M10L

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199597
SMART Domains Protein: ENSMUSP00000143542
Gene: ENSMUSG00000057123

DomainStartEndE-ValueType
CNX 43 76 3.47e-19 SMART
Connexin_CCC 163 229 2.45e-37 SMART
Pfam:Connexin40_C 257 358 2.4e-33 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Gpr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gpr89 APN 3 96898523 missense probably damaging 1.00
IGL00757:Gpr89 APN 3 96871534 missense probably benign 0.00
IGL01114:Gpr89 APN 3 96893549 missense probably damaging 0.98
IGL02417:Gpr89 APN 3 96897425 nonsense probably null
R0207:Gpr89 UTSW 3 96871480 missense probably damaging 0.99
R0650:Gpr89 UTSW 3 96897324 splice site probably benign
R0704:Gpr89 UTSW 3 96880168 critical splice acceptor site probably null
R1496:Gpr89 UTSW 3 96905210 missense probably benign 0.00
R1869:Gpr89 UTSW 3 96875659 missense probably benign 0.16
R1913:Gpr89 UTSW 3 96875633 missense possibly damaging 0.91
R2264:Gpr89 UTSW 3 96872515 missense probably damaging 0.99
R2276:Gpr89 UTSW 3 96897427 missense probably damaging 1.00
R3822:Gpr89 UTSW 3 96892944 missense probably benign 0.03
R3922:Gpr89 UTSW 3 96890899 missense probably damaging 1.00
R5761:Gpr89 UTSW 3 96892880 missense probably damaging 1.00
R6185:Gpr89 UTSW 3 96890833 missense probably damaging 0.99
R7063:Gpr89 UTSW 3 96875698 missense probably damaging 1.00
R7164:Gpr89 UTSW 3 96871398 missense probably benign 0.04
R7215:Gpr89 UTSW 3 96880088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCAGACTTGGACCTCG -3'
(R):5'- TCCAGGCAAACGGAGAATGC -3'

Sequencing Primer
(F):5'- GAGGCAAACGTGTCAGCACC -3'
(R):5'- AGAATGCGGCCGCTGATTG -3'
Posted On2016-05-10