Incidental Mutation 'R5068:Mib1'
ID388507
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
MMRRC Submission 042658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5068 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10793002 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 646 (E646G)
Ref Sequence ENSEMBL: ENSMUSP00000131712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect probably damaging
Transcript: ENSMUST00000052838
AA Change: E646G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: E646G

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124288
AA Change: E280G
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: E280G

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165555
AA Change: E646G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: E646G

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,436 Y155D probably benign Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
6030468B19Rik A G 11: 117,802,875 Y56C possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Add2 T A 6: 86,107,458 L496Q probably damaging Het
Akt1s1 T C 7: 44,850,008 probably null Het
Als2 G T 1: 59,211,274 P437Q probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd17 T C 5: 90,254,808 R1464G probably damaging Het
Ankrd24 T C 10: 81,639,865 S121P possibly damaging Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Bnip3l T C 14: 66,999,632 E57G possibly damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cc2d1b T C 4: 108,623,464 V27A possibly damaging Het
Cdc37 T C 9: 21,149,803 T19A probably damaging Het
Cep152 T C 2: 125,571,816 I1199V probably benign Het
Chd6 G T 2: 160,966,369 L1642I possibly damaging Het
Chst13 T C 6: 90,309,569 E137G possibly damaging Het
Cnrip1 A G 11: 17,054,687 D79G probably damaging Het
Dars2 A T 1: 161,041,913 C589S probably benign Het
Dhx15 T G 5: 52,170,067 I102L possibly damaging Het
Dip2a A G 10: 76,318,043 L151P possibly damaging Het
Dlc1 T C 8: 36,938,030 T202A probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dlgap4 T C 2: 156,707,111 F464L probably benign Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Dthd1 C A 5: 62,818,716 D244E probably benign Het
Dtl A T 1: 191,568,373 D126E probably damaging Het
Ell2 A G 13: 75,763,618 N341S probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Erbb4 A T 1: 68,043,902 probably null Het
Erc2 A T 14: 28,302,943 H593L possibly damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fyn A G 10: 39,526,843 K204E probably damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gm4847 A T 1: 166,638,384 F212Y possibly damaging Het
Gpc5 T C 14: 115,417,264 *499R probably null Het
Hcn4 T C 9: 58,860,021 L955P unknown Het
Hook2 C A 8: 84,993,399 L111I possibly damaging Het
Hook3 C T 8: 26,095,757 probably null Het
Hvcn1 T C 5: 122,233,481 F28S probably damaging Het
Igkv6-32 A G 6: 70,074,283 F30L possibly damaging Het
Inpp5b G A 4: 124,742,649 probably null Het
Itgb2 G A 10: 77,548,761 A239T probably damaging Het
Kcnrg T C 14: 61,607,817 L102P probably damaging Het
Kif16b A T 2: 142,711,707 M1068K probably benign Het
Kifc3 T C 8: 95,110,216 R109G possibly damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Kptn T C 7: 16,123,102 Y172H probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrc1 T A 2: 14,306,516 M868K probably benign Het
Mterf1a T C 5: 3,891,854 N5D probably benign Het
Muc5b T C 7: 141,858,608 S1764P unknown Het
Myo9b T C 8: 71,349,055 Y1275H probably damaging Het
Nek1 T C 8: 61,016,296 I129T probably damaging Het
Net1 G A 13: 3,886,740 A221V probably benign Het
Nuak2 A T 1: 132,331,771 D429V probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr648 T A 7: 104,180,241 S56C probably damaging Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Olfr901 T C 9: 38,430,464 Y61H probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh7 T C 5: 57,722,166 V1021A probably damaging Het
Pclo G C 5: 14,679,073 probably benign Het
Pds5a A C 5: 65,615,272 D1329E probably damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pias3 A G 3: 96,703,855 K431E probably damaging Het
Piwil1 T C 5: 128,741,614 S158P probably damaging Het
Plxnc1 A T 10: 94,799,377 I1329N possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pnpla1 T A 17: 28,879,423 probably null Het
Prdm10 T C 9: 31,359,047 Y827H probably damaging Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rgl3 A G 9: 21,988,044 probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rpp40 T C 13: 35,898,698 N254D probably benign Het
Scin T A 12: 40,124,700 H128L probably damaging Het
Sh3bp2 A T 5: 34,556,967 M225L probably benign Het
Shisa9 C A 16: 12,267,548 H324Q possibly damaging Het
Sipa1l1 A G 12: 82,437,827 D1585G probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slc6a13 T C 6: 121,333,342 L320P probably damaging Het
Spats2l A G 1: 57,943,221 T421A probably benign Het
Spryd3 A T 15: 102,128,611 D207E probably benign Het
Srrt T C 5: 137,296,541 N392S possibly damaging Het
Stk36 G T 1: 74,622,345 R510S probably benign Het
Sucnr1 A G 3: 60,086,867 Y272C probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uap1 G T 1: 170,161,463 P130Q probably damaging Het
Ube3c T C 5: 29,601,354 probably null Het
Umad1 A T 6: 8,401,157 probably null Het
Usp34 T C 11: 23,460,665 V2705A possibly damaging Het
Vps13a T C 19: 16,746,058 S259G probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdfy3 T C 5: 101,894,937 T1983A probably benign Het
Wdr24 T G 17: 25,825,779 F203V possibly damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp282 A C 6: 47,877,703 Q11P probably benign Het
Zfp750 T A 11: 121,512,195 T576S probably benign Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1237:Mib1 UTSW 18 10768149 missense probably damaging 1.00
R1557:Mib1 UTSW 18 10798474 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5322:Mib1 UTSW 18 10792975 missense probably damaging 1.00
R5589:Mib1 UTSW 18 10794488 missense probably benign 0.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGCCTGTGTGTACAAACATG -3'
(R):5'- AGTATTAGAGCGAGGCTGGC -3'

Sequencing Primer
(F):5'- GCCTGTGTGTACAAACATGATTTTC -3'
(R):5'- ACCTCCAAGTGTCTGATGATG -3'
Posted On2016-06-06