Incidental Mutation 'R1557:Mib1'
ID170386
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
MMRRC Submission 039596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1557 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10798474 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 778 (D778E)
Ref Sequence ENSEMBL: ENSMUSP00000131712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect probably damaging
Transcript: ENSMUST00000052838
AA Change: D778E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: D778E

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124288
AA Change: D412E
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: D412E

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000150000
AA Change: D36E
SMART Domains Protein: ENSMUSP00000122879
Gene: ENSMUSG00000024294
AA Change: D36E

DomainStartEndE-ValueType
Blast:ANK 2 27 5e-6 BLAST
RING 78 112 1.8e-1 SMART
RING 125 159 1.9e-1 SMART
RING 222 254 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165555
AA Change: D778E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: D778E

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A C 1: 53,181,866 D68E possibly damaging Het
Abca3 T C 17: 24,399,980 V870A possibly damaging Het
Aldh3a2 A T 11: 61,249,059 F416I probably damaging Het
Armc6 A T 8: 70,225,448 L77Q possibly damaging Het
Asb17 A G 3: 153,850,933 I226V probably benign Het
Aspm A G 1: 139,468,668 I862V probably benign Het
Atr T A 9: 95,871,449 D701E probably damaging Het
Baz1b C T 5: 135,218,243 L849F possibly damaging Het
Cbr1 T C 16: 93,608,789 V97A probably benign Het
Cep295 G A 9: 15,332,010 Q1669* probably null Het
Cfap54 T C 10: 92,984,227 T1242A possibly damaging Het
Chrm3 T A 13: 9,878,314 T229S possibly damaging Het
Cnga3 A G 1: 37,260,985 Y300C probably damaging Het
Col14a1 A C 15: 55,388,579 I544L unknown Het
Crocc T C 4: 141,025,465 E1208G probably damaging Het
Cyp2j8 A T 4: 96,470,476 probably benign Het
Dcbld2 T C 16: 58,465,350 I624T possibly damaging Het
Ddah1 A C 3: 145,891,472 I258L probably benign Het
Dnah6 G A 6: 73,049,131 Q3460* probably null Het
Dync2h1 T A 9: 7,140,911 D1372V probably damaging Het
Egln1 G A 8: 124,948,241 R272* probably null Het
Elf1 A G 14: 79,567,180 D95G possibly damaging Het
Fkbp5 A G 17: 28,402,755 F374L probably damaging Het
Fli1 T C 9: 32,461,244 probably benign Het
Gabbr2 T C 4: 46,846,436 T158A probably damaging Het
Gp2 A C 7: 119,450,079 Y412D probably damaging Het
Hmcn1 A G 1: 150,734,532 V1462A possibly damaging Het
Ide T C 19: 37,280,761 probably null Het
Kalrn T C 16: 34,314,278 K372R possibly damaging Het
Kcnj16 A G 11: 111,025,241 D243G possibly damaging Het
Kif7 A G 7: 79,714,157 M1T probably null Het
Klri2 A T 6: 129,732,211 L226Q probably damaging Het
Kremen1 T C 11: 5,215,373 probably null Het
Lama3 T C 18: 12,513,731 probably benign Het
Lmln C A 16: 33,088,211 R336S probably benign Het
Lrch4 T A 5: 137,637,556 D266E probably benign Het
Lrrc28 C T 7: 67,559,929 R174H probably damaging Het
Msra T C 14: 64,123,326 I125V possibly damaging Het
Olfr1180 A T 2: 88,412,211 V149E possibly damaging Het
Olfr1281 T A 2: 111,328,619 S67T probably damaging Het
Olfr670 A G 7: 104,960,540 F64S probably damaging Het
Olfr790 C A 10: 129,501,622 T246N probably damaging Het
Olfr930 A G 9: 38,930,659 M163V possibly damaging Het
Olfr95 A G 17: 37,211,353 F167L probably damaging Het
Pes1 T A 11: 3,976,824 Y369N probably damaging Het
Pgam2 T C 11: 5,801,773 D221G possibly damaging Het
Prl2c5 T C 13: 13,190,680 V137A possibly damaging Het
Rasal1 T A 5: 120,676,849 D721E possibly damaging Het
Sass6 G T 3: 116,618,732 E385D possibly damaging Het
Sema5a A G 15: 32,460,272 R60G probably benign Het
Sesn1 T C 10: 41,903,766 S399P probably damaging Het
Skiv2l G A 17: 34,848,422 L47F probably damaging Het
Slc10a2 C T 8: 5,091,755 V210M probably damaging Het
Slc8a3 C T 12: 81,315,557 G163S probably damaging Het
Sorbs2 T C 8: 45,759,197 probably benign Het
Speer4f1 T C 5: 17,479,492 W173R probably damaging Het
Spon2 C A 5: 33,216,764 G92W probably damaging Het
Sycp2 A T 2: 178,395,216 probably benign Het
Tex33 C A 15: 78,386,274 R98M probably damaging Het
Tfb1m A G 17: 3,554,966 V84A probably damaging Het
Tmem18 G T 12: 30,587,199 probably null Het
Tom1l1 A G 11: 90,656,384 L290S possibly damaging Het
Tube1 T G 10: 39,145,715 probably null Het
Ugt2b35 T A 5: 87,007,297 probably null Het
Unc93b1 T A 19: 3,942,403 Y269N probably benign Het
Usp16 T C 16: 87,462,142 probably null Het
Vmn1r38 A T 6: 66,776,386 S249T probably benign Het
Vmn1r42 T A 6: 89,844,751 M279L possibly damaging Het
Zdhhc23 T A 16: 43,971,466 T315S possibly damaging Het
Zfp472 T C 17: 32,975,926 F12L probably benign Het
Zfr2 T C 10: 81,247,391 S634P probably benign Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
PIT4466001:Mib1 UTSW 18 10775541 missense probably benign 0.01
PIT4468001:Mib1 UTSW 18 10798463 missense possibly damaging 0.86
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1237:Mib1 UTSW 18 10768149 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5068:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5322:Mib1 UTSW 18 10792975 missense probably damaging 1.00
R5589:Mib1 UTSW 18 10794488 missense probably benign 0.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
R7242:Mib1 UTSW 18 10741011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTTTTACGCTGGAGAGTCG -3'
(R):5'- TCAAGATACCTGCAAGTCCCAGGTC -3'

Sequencing Primer
(F):5'- GTCGATTCACAAATGTGGGG -3'
(R):5'- AGGTCCTCCCTTACAGCG -3'
Posted On2014-04-13