Incidental Mutation 'R0436:Kcnh4'
ID39020
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0436 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100746932 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 633 (G633E)
Ref Sequence ENSEMBL: ENSMUSP00000102986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107361] [ENSMUST00000107363]
Predicted Effect probably benign
Transcript: ENSMUST00000107361
AA Change: G633E

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: G633E

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107363
AA Change: G633E

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: G633E

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R0613:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4823:Kcnh4 UTSW 11 100755174 missense probably damaging 1.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5682:Kcnh4 UTSW 11 100749802 missense possibly damaging 0.82
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACCTTGGCGCAGGTTGAAGGTTAG -3'
(R):5'- CAGTGGCTGTCATTCACTCCAACG -3'

Sequencing Primer
(F):5'- CAGGTTGAAGGTTAGGTCCC -3'
(R):5'- GCACTATAGACATCTTCCACTGG -3'
Posted On2013-05-23