Incidental Mutation 'R5682:Kcnh4'
ID443142
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R5682 (G1)
Quality Score220
Status Not validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100749802 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 466 (M466K)
Ref Sequence ENSEMBL: ENSMUSP00000102986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107361] [ENSMUST00000107363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107361
AA Change: M466K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: M466K

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107363
AA Change: M466K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: M466K

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0436:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R0613:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4823:Kcnh4 UTSW 11 100755174 missense probably damaging 1.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CTACCTCGTTGGCATCGATG -3'
(R):5'- CATCTAAGGATTGCCACCTACTTCC -3'

Sequencing Primer
(F):5'- ATCGATGCCGCTGTTGAC -3'
(R):5'- CCCTGCTTCGATTGCTAGTTG -3'
Posted On2016-11-09