Incidental Mutation 'R5013:Tmem198b'
ID390655
Institutional Source Beutler Lab
Gene Symbol Tmem198b
Ensembl Gene ENSMUSG00000047090
Gene Nametransmembrane protein 198b
Synonyms1110012D08Rik
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5013 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location128800036-128804370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128802073 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 207 (R207H)
Ref Sequence ENSEMBL: ENSMUSP00000050451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026410] [ENSMUST00000026411] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000217745] [ENSMUST00000218001] [ENSMUST00000218511] [ENSMUST00000219404] [ENSMUST00000219508]
Predicted Effect probably benign
Transcript: ENSMUST00000026410
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026411
SMART Domains Protein: ENSMUSP00000026411
Gene: ENSMUSG00000025355

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 26 81 6.7e-10 PFAM
ZnMc 101 258 5.13e-43 SMART
low complexity region 262 271 N/A INTRINSIC
HX 293 335 8.97e-8 SMART
HX 337 378 1e-5 SMART
HX 380 427 1.87e-5 SMART
HX 429 471 3.7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000051011
AA Change: R207H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090
AA Change: R207H

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217745
Predicted Effect probably benign
Transcript: ENSMUST00000218001
Predicted Effect probably benign
Transcript: ENSMUST00000218511
Predicted Effect probably benign
Transcript: ENSMUST00000219404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219473
Predicted Effect probably benign
Transcript: ENSMUST00000219508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219535
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing compared with wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Tmem198b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Tmem198b APN 10 128803145 missense probably damaging 1.00
IGL02623:Tmem198b APN 10 128802451 missense probably damaging 1.00
R1636:Tmem198b UTSW 10 128802196 missense probably damaging 0.99
R2922:Tmem198b UTSW 10 128802193 missense probably damaging 1.00
R4724:Tmem198b UTSW 10 128801481 missense probably damaging 0.99
R5092:Tmem198b UTSW 10 128801436 missense probably benign
R5107:Tmem198b UTSW 10 128802287 missense probably benign
R5818:Tmem198b UTSW 10 128802188 missense probably benign 0.02
R5930:Tmem198b UTSW 10 128801454 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTCAAGTATAGAATCCGGGGACAG -3'
(R):5'- ATCTACCAGCCGCATTCAGC -3'

Sequencing Primer
(F):5'- TCCGGGGACAGAAGCAG -3'
(R):5'- ATTCAGCCTGGGTGCCG -3'
Posted On2016-06-06