Incidental Mutation 'IGL03048:Gm8994'
ID391812
Institutional Source Beutler Lab
Gene Symbol Gm8994
Ensembl Gene ENSMUSG00000094973
Gene Namepredicted gene 8994
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #IGL03048 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location136327539-136329983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136329200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 220 (T220S)
Ref Sequence ENSEMBL: ENSMUSP00000144809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077886] [ENSMUST00000204530] [ENSMUST00000204966]
Predicted Effect probably damaging
Transcript: ENSMUST00000077886
AA Change: T220S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133154
Gene: ENSMUSG00000094973
AA Change: T220S

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204530
AA Change: T220S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144809
Gene: ENSMUSG00000094973
AA Change: T220S

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204966
AA Change: T199S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145166
Gene: ENSMUSG00000094973
AA Change: T199S

DomainStartEndE-ValueType
DEXDc 57 233 1.8e-41 SMART
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,978,699 probably null Het
Anapc4 C T 5: 52,839,733 T116I probably benign Het
Arhgap45 C T 10: 80,017,017 R14C probably damaging Het
BC055324 G A 1: 163,964,525 A608V probably benign Het
Bysl T C 17: 47,602,635 probably null Het
Ccdc166 T A 15: 75,982,201 N10I possibly damaging Het
Chd1l T C 3: 97,597,763 S163G probably benign Het
Col6a3 A G 1: 90,810,248 V576A possibly damaging Het
Cpped1 T C 16: 11,828,475 T162A probably benign Het
Dcbld1 A T 10: 52,304,626 I200F probably damaging Het
Dock6 T C 9: 21,809,570 E1713G probably damaging Het
Evx1 T C 6: 52,315,754 L130P probably benign Het
Fam168a A G 7: 100,835,338 T228A probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxp4 A T 17: 47,880,840 M124K unknown Het
Gabrr3 A G 16: 59,430,130 H164R probably benign Het
Gm3839 T A 14: 11,281,873 I21F probably benign Het
Greb1 C T 12: 16,733,331 C134Y probably damaging Het
Hddc2 G A 10: 31,316,336 V79I possibly damaging Het
Lbr T C 1: 181,838,544 probably benign Het
Mamdc4 C T 2: 25,569,072 R229K possibly damaging Het
Mtor T C 4: 148,546,390 probably benign Het
Ncoa1 T C 12: 4,267,922 R1137G probably damaging Het
Nlrp4d T C 7: 10,358,954 noncoding transcript Het
Oasl1 T A 5: 114,937,341 S487T possibly damaging Het
Olfr385 G C 11: 73,589,005 H244Q possibly damaging Het
Olfr736 G T 14: 50,392,788 V11L possibly damaging Het
Olfr952 A G 9: 39,426,769 F101L probably benign Het
Oprm1 T C 10: 6,829,064 I91T probably damaging Het
Pdzk1ip1 T A 4: 115,092,984 D147E probably benign Het
Per1 A G 11: 69,104,726 K711E probably damaging Het
Rab3gap1 A G 1: 127,937,477 N734S probably damaging Het
Rapgefl1 T C 11: 98,837,164 L4P possibly damaging Het
Sgk2 A G 2: 162,995,760 Y101C probably damaging Het
Tmem129 A G 5: 33,655,467 V179A possibly damaging Het
Ttn T C 2: 76,888,915 probably benign Het
Ttyh2 T A 11: 114,696,695 M174K probably benign Het
Vmn2r13 G A 5: 109,156,285 A760V probably damaging Het
Vmn2r82 A T 10: 79,396,626 I820F probably damaging Het
Zswim4 T C 8: 84,211,975 M1093V possibly damaging Het
Other mutations in Gm8994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gm8994 APN 6 136329111 missense probably damaging 1.00
IGL02480:Gm8994 APN 6 136329215 missense probably damaging 1.00
R0153:Gm8994 UTSW 6 136328844 missense probably damaging 0.99
R1602:Gm8994 UTSW 6 136328780 missense probably damaging 0.98
R2258:Gm8994 UTSW 6 136328561 missense probably benign 0.00
R3915:Gm8994 UTSW 6 136329422 missense probably benign 0.04
R4898:Gm8994 UTSW 6 136328739 missense possibly damaging 0.60
R4902:Gm8994 UTSW 6 136329264 missense probably benign 0.42
R5349:Gm8994 UTSW 6 136329696 missense probably damaging 1.00
R5488:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5491:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5493:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5494:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5548:Gm8994 UTSW 6 136329570 missense probably damaging 0.99
R5668:Gm8994 UTSW 6 136329395 missense probably benign 0.00
R5998:Gm8994 UTSW 6 136328624 missense probably benign 0.23
R6393:Gm8994 UTSW 6 136328598 missense probably benign
R6898:Gm8994 UTSW 6 136328619 missense probably benign 0.10
R7180:Gm8994 UTSW 6 136329537 missense probably damaging 1.00
R7193:Gm8994 UTSW 6 136329215 missense probably damaging 1.00
R7274:Gm8994 UTSW 6 136329398 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACATCCGGAAGCTGGACTAC -3'
(R):5'- CTCTTGGTGATGCAGAAGATGACG -3'

Sequencing Primer
(F):5'- TGGACTACGGGCAGCATGTG -3'
(R):5'- TGCAGAAGATGACGGCCTG -3'
Posted On2016-06-07