Incidental Mutation 'R5124:Cop1'
ID393427
Institutional Source Beutler Lab
Gene Symbol Cop1
Ensembl Gene ENSMUSG00000040782
Gene NameCOP1, E3 ubiquitin ligase
SynonymsCop1
MMRRC Submission 042712-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R5124 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location159232320-159347640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 159278112 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000141200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076894] [ENSMUST00000192215] [ENSMUST00000195044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076894
AA Change: Y333C

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076160
Gene: ENSMUSG00000040782
AA Change: Y333C

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
RING 138 175 3.69e-8 SMART
coiled coil region 235 305 N/A INTRINSIC
WD40 412 451 1.72e0 SMART
WD40 462 501 3.4e-2 SMART
WD40 504 544 3.42e-7 SMART
WD40 547 586 6.79e-2 SMART
WD40 590 628 1.9e-5 SMART
WD40 631 670 4.46e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192215
AA Change: Y259C

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141285
Gene: ENSMUSG00000040782
AA Change: Y259C

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
RING 68 105 1.8e-10 SMART
coiled coil region 161 231 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192762
AA Change: Y123C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194713
Predicted Effect probably damaging
Transcript: ENSMUST00000195044
AA Change: Y33C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141200
Gene: ENSMUSG00000040782
AA Change: Y33C

DomainStartEndE-ValueType
WD40 112 151 1.1e-2 SMART
WD40 162 201 2.1e-4 SMART
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in prostate epithelial cells exhibit prostate gland hyperplasia and prostate intraepithelial neoplasia due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk A G 9: 59,315,278 D496G possibly damaging Het
Agbl4 A G 4: 111,656,328 M424V probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Bpifa3 C T 2: 154,138,137 Q230* probably null Het
Cog4 G T 8: 110,847,193 R48L probably damaging Het
Cyp26a1 A T 19: 37,701,217 I454L probably benign Het
Ddr1 T C 17: 35,683,597 H762R probably damaging Het
Dnajc2 A T 5: 21,763,484 S328T probably benign Het
Dppa2 G T 16: 48,311,623 V28F probably damaging Het
Dusp15 T A 2: 152,951,355 M1L possibly damaging Het
Eml5 G A 12: 98,792,042 T1875M probably damaging Het
Fam186a A G 15: 99,943,096 S1756P possibly damaging Het
Gm436 A T 4: 144,674,719 I65N probably damaging Het
Gm5431 T A 11: 48,889,039 Q630L probably benign Het
Gm9733 T A 3: 15,320,579 R88* probably null Het
H6pd A G 4: 149,982,055 S625P possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj6 G T 16: 94,832,659 P180T probably damaging Het
Lpin3 T A 2: 160,897,061 M263K probably benign Het
Lrp2 A T 2: 69,501,490 D1640E probably damaging Het
Lypd2 C T 15: 74,732,498 A74T probably benign Het
Map4k1 T C 7: 28,988,832 L223P probably damaging Het
Myh7 A T 14: 54,985,742 Y715* probably null Het
Myo9b T C 8: 71,355,839 S1697P probably damaging Het
Neb T C 2: 52,281,498 E1661G probably damaging Het
Nek8 A T 11: 78,172,939 M80K probably damaging Het
Nup188 T A 2: 30,330,935 L979Q probably damaging Het
Olfr1218 A T 2: 89,055,087 V113D probably damaging Het
P4htm T A 9: 108,581,942 S264C possibly damaging Het
Pcdha8 A G 18: 36,993,715 T417A probably benign Het
Pclo T C 5: 14,677,392 probably benign Het
Prox1 T A 1: 190,161,279 N323I possibly damaging Het
Prune2 A T 19: 17,199,910 R222S probably damaging Het
Psmd2 C A 16: 20,652,698 R100S possibly damaging Het
Qrich2 A T 11: 116,446,773 M1963K probably damaging Het
Rbm39 C T 2: 156,159,162 G324D probably damaging Het
Rhobtb1 A T 10: 69,269,901 probably null Het
Rhov G T 2: 119,271,087 P13T unknown Het
Sec14l3 A G 11: 4,075,209 D273G possibly damaging Het
Slco2a1 T A 9: 103,050,166 I86N probably damaging Het
Smg1 A T 7: 118,213,012 S19T probably benign Het
Stk32a T C 18: 43,305,017 S194P probably benign Het
Syna G A 5: 134,559,570 S175L possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem151b T C 17: 45,547,119 Y67C probably damaging Het
Tshz1 C T 18: 84,015,467 R272Q probably damaging Het
Tti1 A G 2: 158,008,195 S375P probably damaging Het
Vcan T C 13: 89,725,517 K73E probably damaging Het
Vmn1r202 C T 13: 22,501,750 V166I probably benign Het
Vmn2r10 A G 5: 109,006,420 V6A probably benign Het
Zfhx4 A G 3: 5,242,047 D111G probably damaging Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Cop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Cop1 APN 1 159308878 unclassified probably benign
IGL02945:Cop1 APN 1 159306689 missense probably benign 0.20
IGL03059:Cop1 APN 1 159306709 missense probably damaging 1.00
R0032:Cop1 UTSW 1 159325036 critical splice donor site probably null
R0179:Cop1 UTSW 1 159250066 missense probably benign 0.20
R0846:Cop1 UTSW 1 159319816 missense probably benign 0.26
R0988:Cop1 UTSW 1 159232847 missense possibly damaging 0.76
R0988:Cop1 UTSW 1 159244672 missense probably damaging 1.00
R2296:Cop1 UTSW 1 159244650 missense possibly damaging 0.92
R2297:Cop1 UTSW 1 159252554 missense possibly damaging 0.53
R2504:Cop1 UTSW 1 159232805 missense probably damaging 0.98
R2974:Cop1 UTSW 1 159324929 missense possibly damaging 0.95
R4889:Cop1 UTSW 1 159284589 missense probably damaging 1.00
R4965:Cop1 UTSW 1 159239597 missense probably damaging 0.99
R4981:Cop1 UTSW 1 159325068 unclassified probably benign
R5263:Cop1 UTSW 1 159324937 missense probably damaging 1.00
R5268:Cop1 UTSW 1 159327164 missense probably damaging 1.00
R5470:Cop1 UTSW 1 159266860 intron probably benign
R5595:Cop1 UTSW 1 159250073 missense probably benign 0.00
R5919:Cop1 UTSW 1 159319724 missense probably damaging 1.00
R6386:Cop1 UTSW 1 159289031 missense probably damaging 1.00
R6865:Cop1 UTSW 1 159308954 missense probably damaging 1.00
R6995:Cop1 UTSW 1 159306584 missense probably damaging 1.00
R7056:Cop1 UTSW 1 159250077 missense probably damaging 0.98
R7146:Cop1 UTSW 1 159244352 intron probably null
R7242:Cop1 UTSW 1 159284548 missense probably benign 0.00
R7309:Cop1 UTSW 1 159306625 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCCGATGTGCTAACTGATCTTATG -3'
(R):5'- CCCGAGACAAGCAATTCCTG -3'

Sequencing Primer
(F):5'- TTTTGATGTGTATGCTTGAGGAG -3'
(R):5'- GCAATTCCTGACAATATTTTCTCAC -3'
Posted On2016-06-15