Incidental Mutation 'R5114:Ralgapa1'
ID394106
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 042702-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R5114 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55612723 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2004 (V2004A)
Ref Sequence ENSEMBL: ENSMUSP00000151498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085385
AA Change: V2004A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: V2004A

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110687
AA Change: V2004A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: V2004A

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000219323
AA Change: V55A
Predicted Effect possibly damaging
Transcript: ENSMUST00000219432
AA Change: V2051A

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000219451
AA Change: S45P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219516
Predicted Effect possibly damaging
Transcript: ENSMUST00000220367
AA Change: V2004A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226244
AA Change: V2460A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,358 M431L probably benign Het
1700066B19Rik A G 18: 35,728,841 Y126C probably damaging Het
1810041L15Rik T C 15: 84,417,226 D72G probably damaging Het
5830454E08Rik T A 9: 120,577,627 probably benign Het
Ada G A 2: 163,730,486 R225C probably benign Het
Adamts9 T C 6: 92,890,273 K625R probably benign Het
Ano1 T C 7: 144,657,083 I182V possibly damaging Het
Aox4 T C 1: 58,246,286 V643A possibly damaging Het
Arcn1 T C 9: 44,760,144 I29V probably benign Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Asb10 A T 5: 24,540,742 L62Q probably damaging Het
Atp23 T A 10: 126,887,534 H233L possibly damaging Het
BC005561 T A 5: 104,519,876 F755I probably damaging Het
Bglap2 C T 3: 88,382,125 probably benign Het
Carnmt1 T C 19: 18,677,734 S84P probably damaging Het
Ccdc152 A G 15: 3,282,837 I180T probably damaging Het
Cdr2l T C 11: 115,393,360 F174S probably damaging Het
Celsr2 C T 3: 108,393,996 V2695I probably benign Het
Chd1 C A 17: 15,728,198 S127R probably benign Het
Chmp4c T A 3: 10,385,586 F75L probably benign Het
Col13a1 A C 10: 61,890,101 V260G possibly damaging Het
Col5a1 A G 2: 28,025,652 N183D probably damaging Het
Cpn1 C T 19: 43,986,195 V32M probably damaging Het
Cxcl1 A G 5: 90,891,514 M39V probably benign Het
Dpep2 T A 8: 105,986,193 D455V probably damaging Het
Dpp7 G A 2: 25,352,737 T441I possibly damaging Het
Dst C A 1: 34,202,559 H4001N probably damaging Het
Epg5 G A 18: 77,995,613 A1519T probably benign Het
Esrp2 C T 8: 106,132,188 V606I probably benign Het
Fbxo40 T C 16: 36,968,874 K625E probably damaging Het
Gbp2b A T 3: 142,598,185 I14F probably damaging Het
Gpr37l1 G T 1: 135,166,938 F189L probably damaging Het
Heatr5a G A 12: 51,956,237 Q161* probably null Het
Hspa4l T C 3: 40,745,765 Y30H possibly damaging Het
Hspg2 G A 4: 137,511,926 C388Y probably damaging Het
Kcna1 A G 6: 126,642,367 I330T probably damaging Het
Klhl3 T A 13: 58,018,967 Y350F probably benign Het
Kntc1 T C 5: 123,781,055 probably null Het
Krtap10-4 A T 10: 77,826,686 C109* probably null Het
Lrch4 T C 5: 137,637,917 S377P probably benign Het
Lrrc8c C A 5: 105,607,483 H375N probably damaging Het
Lsg1 T C 16: 30,561,720 E633G probably damaging Het
Mcoln1 T C 8: 3,510,697 probably benign Het
Med12l C A 3: 59,259,688 T1523K possibly damaging Het
Mrps27 A T 13: 99,411,465 probably benign Het
Mzb1 T A 18: 35,647,664 Y158F probably benign Het
Nat8l T A 5: 33,998,479 C160S probably damaging Het
Ncf4 T C 15: 78,262,393 probably benign Het
Olfr362 A T 2: 37,104,802 Y283N probably damaging Het
Olfr98 T C 17: 37,262,839 Y275C probably damaging Het
Pak2 T A 16: 32,043,118 probably benign Het
Pcdhga12 T C 18: 37,768,107 I664T probably benign Het
Pcnx2 A C 8: 125,838,010 L1048R possibly damaging Het
Pcsk5 T C 19: 17,675,585 M246V probably damaging Het
Pkd2l2 T A 18: 34,433,302 V522D probably benign Het
Plekhh1 A T 12: 79,069,106 M808L probably benign Het
Plpp2 C A 10: 79,527,139 R157L probably benign Het
Plrg1 T A 3: 83,071,251 H441Q probably benign Het
Pnpla6 T C 8: 3,522,613 V300A probably damaging Het
Ptprb A T 10: 116,348,183 K1633N possibly damaging Het
Rasd1 G T 11: 59,964,107 S182R possibly damaging Het
Rc3h2 A T 2: 37,398,361 probably null Het
Rrp1b T A 17: 32,036,471 probably benign Het
Ruvbl1 T C 6: 88,497,290 I425T probably benign Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Slc12a2 A G 18: 57,899,272 Y348C probably damaging Het
Slc14a2 C A 18: 78,195,748 V219L possibly damaging Het
Smc1b G T 15: 85,064,984 P1242Q probably damaging Het
Snx27 T A 3: 94,524,244 D281V probably damaging Het
Spem2 C T 11: 69,817,147 V331I probably benign Het
Sptb C A 12: 76,609,278 K1343N probably damaging Het
Sult2a8 T C 7: 14,413,659 I236V probably benign Het
Syk A G 13: 52,611,035 E66G probably damaging Het
Synm T A 7: 67,735,658 E310V probably damaging Het
Tas2r118 G A 6: 23,969,210 A284V probably benign Het
Tlr11 A G 14: 50,363,121 N855D possibly damaging Het
Tmem230 G T 2: 132,245,951 probably benign Het
Trappc8 G A 18: 20,844,180 T844I probably benign Het
Trmt44 T C 5: 35,565,468 S419G possibly damaging Het
Trpv1 T A 11: 73,241,748 V396E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp2 A G 7: 140,007,441 I337T possibly damaging Het
Ubr4 T C 4: 139,410,623 I1097T probably damaging Het
Vmn2r61 T C 7: 42,300,529 F791S possibly damaging Het
Zdhhc2 T A 8: 40,445,784 M45K probably benign Het
Zfp383 T A 7: 29,914,741 D140E probably damaging Het
Zfp712 C A 13: 67,041,361 K367N probably damaging Het
Zfp763 C T 17: 33,018,975 A399T probably damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6593:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGCCAAACTCAAACAGTCATGG -3'
(R):5'- TTGTCATGGAGTCAAGAGAAATTCC -3'

Sequencing Primer
(F):5'- CGAGTGACCAGCACTTTC -3'
(R):5'- TGGAGTCAAGAGAAATTCCATTTAG -3'
Posted On2016-06-15