Incidental Mutation 'R5114:Syk'
ID394110
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
MMRRC Submission 042702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5114 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52611035 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 66 (E66G)
Ref Sequence ENSEMBL: ENSMUSP00000113852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
PDB Structure
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived doubly phosphorylated peptide [SOLUTION NMR]
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived singly phosphorylated peptide [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000055087
AA Change: E66G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: E66G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118756
AA Change: E66G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: E66G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120135
AA Change: E66G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: E66G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150672
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,358 M431L probably benign Het
1700066B19Rik A G 18: 35,728,841 Y126C probably damaging Het
1810041L15Rik T C 15: 84,417,226 D72G probably damaging Het
5830454E08Rik T A 9: 120,577,627 probably benign Het
Ada G A 2: 163,730,486 R225C probably benign Het
Adamts9 T C 6: 92,890,273 K625R probably benign Het
Ano1 T C 7: 144,657,083 I182V possibly damaging Het
Aox4 T C 1: 58,246,286 V643A possibly damaging Het
Arcn1 T C 9: 44,760,144 I29V probably benign Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Asb10 A T 5: 24,540,742 L62Q probably damaging Het
Atp23 T A 10: 126,887,534 H233L possibly damaging Het
BC005561 T A 5: 104,519,876 F755I probably damaging Het
Bglap2 C T 3: 88,382,125 probably benign Het
Carnmt1 T C 19: 18,677,734 S84P probably damaging Het
Ccdc152 A G 15: 3,282,837 I180T probably damaging Het
Cdr2l T C 11: 115,393,360 F174S probably damaging Het
Celsr2 C T 3: 108,393,996 V2695I probably benign Het
Chd1 C A 17: 15,728,198 S127R probably benign Het
Chmp4c T A 3: 10,385,586 F75L probably benign Het
Col13a1 A C 10: 61,890,101 V260G possibly damaging Het
Col5a1 A G 2: 28,025,652 N183D probably damaging Het
Cpn1 C T 19: 43,986,195 V32M probably damaging Het
Cxcl1 A G 5: 90,891,514 M39V probably benign Het
Dpep2 T A 8: 105,986,193 D455V probably damaging Het
Dpp7 G A 2: 25,352,737 T441I possibly damaging Het
Dst C A 1: 34,202,559 H4001N probably damaging Het
Epg5 G A 18: 77,995,613 A1519T probably benign Het
Esrp2 C T 8: 106,132,188 V606I probably benign Het
Fbxo40 T C 16: 36,968,874 K625E probably damaging Het
Gbp2b A T 3: 142,598,185 I14F probably damaging Het
Gpr37l1 G T 1: 135,166,938 F189L probably damaging Het
Heatr5a G A 12: 51,956,237 Q161* probably null Het
Hspa4l T C 3: 40,745,765 Y30H possibly damaging Het
Hspg2 G A 4: 137,511,926 C388Y probably damaging Het
Kcna1 A G 6: 126,642,367 I330T probably damaging Het
Klhl3 T A 13: 58,018,967 Y350F probably benign Het
Kntc1 T C 5: 123,781,055 probably null Het
Krtap10-4 A T 10: 77,826,686 C109* probably null Het
Lrch4 T C 5: 137,637,917 S377P probably benign Het
Lrrc8c C A 5: 105,607,483 H375N probably damaging Het
Lsg1 T C 16: 30,561,720 E633G probably damaging Het
Mcoln1 T C 8: 3,510,697 probably benign Het
Med12l C A 3: 59,259,688 T1523K possibly damaging Het
Mrps27 A T 13: 99,411,465 probably benign Het
Mzb1 T A 18: 35,647,664 Y158F probably benign Het
Nat8l T A 5: 33,998,479 C160S probably damaging Het
Ncf4 T C 15: 78,262,393 probably benign Het
Olfr362 A T 2: 37,104,802 Y283N probably damaging Het
Olfr98 T C 17: 37,262,839 Y275C probably damaging Het
Pak2 T A 16: 32,043,118 probably benign Het
Pcdhga12 T C 18: 37,768,107 I664T probably benign Het
Pcnx2 A C 8: 125,838,010 L1048R possibly damaging Het
Pcsk5 T C 19: 17,675,585 M246V probably damaging Het
Pkd2l2 T A 18: 34,433,302 V522D probably benign Het
Plekhh1 A T 12: 79,069,106 M808L probably benign Het
Plpp2 C A 10: 79,527,139 R157L probably benign Het
Plrg1 T A 3: 83,071,251 H441Q probably benign Het
Pnpla6 T C 8: 3,522,613 V300A probably damaging Het
Ptprb A T 10: 116,348,183 K1633N possibly damaging Het
Ralgapa1 A G 12: 55,612,723 V2004A possibly damaging Het
Rasd1 G T 11: 59,964,107 S182R possibly damaging Het
Rc3h2 A T 2: 37,398,361 probably null Het
Rrp1b T A 17: 32,036,471 probably benign Het
Ruvbl1 T C 6: 88,497,290 I425T probably benign Het
Sipa1l1 C T 12: 82,440,908 A1652V probably benign Het
Slc12a2 A G 18: 57,899,272 Y348C probably damaging Het
Slc14a2 C A 18: 78,195,748 V219L possibly damaging Het
Smc1b G T 15: 85,064,984 P1242Q probably damaging Het
Snx27 T A 3: 94,524,244 D281V probably damaging Het
Spem2 C T 11: 69,817,147 V331I probably benign Het
Sptb C A 12: 76,609,278 K1343N probably damaging Het
Sult2a8 T C 7: 14,413,659 I236V probably benign Het
Synm T A 7: 67,735,658 E310V probably damaging Het
Tas2r118 G A 6: 23,969,210 A284V probably benign Het
Tlr11 A G 14: 50,363,121 N855D possibly damaging Het
Tmem230 G T 2: 132,245,951 probably benign Het
Trappc8 G A 18: 20,844,180 T844I probably benign Het
Trmt44 T C 5: 35,565,468 S419G possibly damaging Het
Trpv1 T A 11: 73,241,748 V396E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp2 A G 7: 140,007,441 I337T possibly damaging Het
Ubr4 T C 4: 139,410,623 I1097T probably damaging Het
Vmn2r61 T C 7: 42,300,529 F791S possibly damaging Het
Zdhhc2 T A 8: 40,445,784 M45K probably benign Het
Zfp383 T A 7: 29,914,741 D140E probably damaging Het
Zfp712 C A 13: 67,041,361 K367N probably damaging Het
Zfp763 C T 17: 33,018,975 A399T probably damaging Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7496:Syk UTSW 13 52612416 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACACTTCCCAGAACTCTGAAG -3'
(R):5'- TTCAGGTCCTCAAAGGGTCC -3'

Sequencing Primer
(F):5'- TTCCCAGAACTCTGAAGGGGTG -3'
(R):5'- TCCTCAAAGGGTCCGGTCTTG -3'
Posted On2016-06-15