Incidental Mutation 'R5154:Olfr1102'
ID396555
Institutional Source Beutler Lab
Gene Symbol Olfr1102
Ensembl Gene ENSMUSG00000049843
Gene Nameolfactory receptor 1102
SynonymsMOR179-4, GA_x6K02T2Q125-48487992-48488966
MMRRC Submission 042736-MU
Accession Numbers

Ncbi RefSeq: NM_207154.2; MGI: 3030936

Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5154 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86998398-87003618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87002038 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000149634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055129] [ENSMUST00000214002]
Predicted Effect probably benign
Transcript: ENSMUST00000055129
AA Change: V23A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052861
Gene: ENSMUSG00000049843
AA Change: V23A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7tm_4 43 320 8.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 47 322 8.7e-6 PFAM
Pfam:7tm_1 53 302 3.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214002
AA Change: V23A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,938 H48P probably damaging Het
Angptl7 C T 4: 148,497,425 R168H probably damaging Het
Ankrd11 A C 8: 122,893,139 F1325V probably damaging Het
Ankrd13c A G 3: 157,988,660 D266G possibly damaging Het
Apold1 A T 6: 134,983,673 H30L possibly damaging Het
Arel1 A G 12: 84,931,773 F362L probably benign Het
Arhgef4 T A 1: 34,732,374 M1254K probably benign Het
Arid2 T A 15: 96,401,985 V1793E probably damaging Het
Bcl7a T C 5: 123,369,359 S156P probably damaging Het
Cbr3 A G 16: 93,685,139 I128V probably benign Het
Cct6b G A 11: 82,739,695 P299L probably damaging Het
Cd180 A T 13: 102,705,774 N443Y probably damaging Het
Cd80 A G 16: 38,473,980 K75R probably benign Het
Cdk1 A T 10: 69,340,468 probably benign Het
Cep192 T A 18: 67,850,684 F1565I probably damaging Het
Chtf18 T C 17: 25,723,720 T412A probably damaging Het
Cit T C 5: 115,988,405 L1590P probably damaging Het
Clcn2 T A 16: 20,703,303 R845S probably benign Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Cnnm2 A T 19: 46,763,132 R454W probably benign Het
Cpne8 T G 15: 90,499,918 I480L probably benign Het
Cr2 A G 1: 195,159,446 W400R probably damaging Het
Cul5 A G 9: 53,625,867 L528P probably damaging Het
Dlgap5 C T 14: 47,413,720 V119M probably damaging Het
Dnah12 T C 14: 26,849,363 S190P probably benign Het
Dnah3 T A 7: 119,952,419 K2881N probably damaging Het
Dnmt3a A T 12: 3,896,008 I288F probably damaging Het
Dse T A 10: 34,153,661 T478S possibly damaging Het
Edn1 C T 13: 42,305,023 T104I probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eprs A G 1: 185,413,465 H1157R probably damaging Het
Fam168b G A 1: 34,818,099 T179I possibly damaging Het
Fzd5 A G 1: 64,735,972 V210A probably benign Het
Gm9742 T C 13: 8,035,045 noncoding transcript Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Gpr141 C T 13: 19,752,242 R121K probably benign Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Grk3 A T 5: 112,941,717 I281N probably damaging Het
Hnrnpdl A T 5: 100,036,512 Y289* probably null Het
Hsf2 T G 10: 57,504,712 V214G probably benign Het
Igf2bp1 G A 11: 95,963,547 Q563* probably null Het
Il31ra T A 13: 112,523,997 D605V possibly damaging Het
Insm2 G A 12: 55,600,197 C242Y probably damaging Het
Ints3 C T 3: 90,415,561 V121I probably benign Het
Kcnt2 A T 1: 140,351,256 L48F possibly damaging Het
Kit G A 5: 75,640,540 V529M probably damaging Het
Mark2 G A 19: 7,283,074 P13S probably damaging Het
Mthfsd A G 8: 121,098,740 V364A probably damaging Het
Mtmr11 C G 3: 96,164,319 S185R probably benign Het
Myot A G 18: 44,354,214 I373V probably benign Het
N4bp3 A T 11: 51,645,312 V231D probably benign Het
Olfr1089 A T 2: 86,732,777 Y278* probably null Het
Pdcd6ip A G 9: 113,691,542 F125L probably damaging Het
Prpf39 A T 12: 65,048,277 Q124L probably benign Het
Reln A T 5: 21,988,765 N1398K probably damaging Het
Rhod A T 19: 4,432,094 D97E probably damaging Het
Rxra T C 2: 27,757,868 probably null Het
Slc1a3 T C 15: 8,642,949 I349V probably benign Het
Slc37a2 A T 9: 37,231,643 *502R probably null Het
Slc9b1 T C 3: 135,373,179 I199T probably damaging Het
Spg20 C T 3: 55,117,329 P115L probably damaging Het
Tnpo1 A T 13: 98,870,305 C205S possibly damaging Het
Tubb1 T A 2: 174,456,864 I113N probably benign Het
Tyrp1 G A 4: 80,850,717 V483I probably benign Het
Vwde T C 6: 13,215,758 S100G probably benign Het
Zfhx3 A T 8: 108,800,575 I1035F probably damaging Het
Zfp618 G T 4: 63,133,209 K742N probably damaging Het
Zfp873 T C 10: 82,060,191 V252A possibly damaging Het
Other mutations in Olfr1102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1102 APN 2 87002923 missense probably benign 0.31
IGL01584:Olfr1102 APN 2 87002151 missense probably benign 0.04
IGL01913:Olfr1102 APN 2 87002820 missense possibly damaging 0.68
IGL02672:Olfr1102 APN 2 87002073 missense probably benign 0.00
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R1674:Olfr1102 UTSW 2 87002233 missense probably benign 0.07
R1688:Olfr1102 UTSW 2 87002386 missense probably benign 0.01
R3826:Olfr1102 UTSW 2 87002044 missense probably damaging 0.97
R3925:Olfr1102 UTSW 2 87002374 missense possibly damaging 0.91
R4023:Olfr1102 UTSW 2 87002922 nonsense probably null
R4730:Olfr1102 UTSW 2 87002166 missense possibly damaging 0.48
R5525:Olfr1102 UTSW 2 87002339 missense possibly damaging 0.95
R5685:Olfr1102 UTSW 2 87002277 missense probably benign 0.02
R5788:Olfr1102 UTSW 2 87002301 missense probably benign 0.01
R6280:Olfr1102 UTSW 2 87002020 missense probably damaging 0.99
R7178:Olfr1102 UTSW 2 87002535 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGAGTAATGCATCTACTCAGACTCAC -3'
(R):5'- TACTGAAGAAAAGCAGGCATCC -3'

Sequencing Primer
(F):5'- AATGCATCTACTCAGACTCACTTTAC -3'
(R):5'- GTGAATCCTCGATGACCA -3'
Posted On2016-06-21