Mutagenetix > Incidental Mutation

Incidental Mutation 'R5204:Clock'

398333

Institutional Source

Beutler Lab

Gene Symbol

Clock

Ensembl Gene

ENSMUSG00000029238

Gene Name

clock circadian regulator

Synonyms

bHLHe8, KAT13D, 5330400M04Rik

MMRRC Submission

042779-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.728) question?

Stock #

R5204 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76357715-76452639 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 76391017 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202122] [ENSMUST00000202651] [ENSMUST00000202651]

AlphaFold

O08785

Predicted Effect

probably null
Transcript: ENSMUST00000075159

SMART Domains

Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000075159

SMART Domains

Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202122

SMART Domains

Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
TFS2N	34	106	4.1e-3	SMART
HLH	40	90	3.4e-14	SMART
PAS	109	175	9.6e-9	SMART
PAS	264	330	1.8e-6	SMART
PAC	336	379	3.9e-9	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	737	795	N/A	INTRINSIC
low complexity region	817	836	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202122

SMART Domains

Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
TFS2N	34	106	4.1e-3	SMART
HLH	40	90	3.4e-14	SMART
PAS	109	175	9.6e-9	SMART
PAS	264	330	1.8e-6	SMART
PAC	336	379	3.9e-9	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	737	795	N/A	INTRINSIC
low complexity region	817	836	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202651

SMART Domains

Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202651

SMART Domains

Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202857

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	A	T	11: 101,297,752 (GRCm39)	L532Q	probably damaging	Het
Abt1	G	A	13: 23,606,838 (GRCm39)	R88C	probably damaging	Het
Aopep	G	A	13: 63,180,904 (GRCm39)	V289I	probably benign	Het
Arhgef7	T	A	8: 11,850,775 (GRCm39)	L129*	probably null	Het
Arid1b	T	C	17: 5,393,316 (GRCm39)	V2282A	probably damaging	Het
Bivm	G	C	1: 44,177,738 (GRCm39)	G346A	probably damaging	Het
Cav1	T	C	6: 17,339,254 (GRCm39)	L102P	probably damaging	Het
Ccdc57	A	G	11: 120,776,888 (GRCm39)	V504A	possibly damaging	Het
Cd7	A	T	11: 120,928,860 (GRCm39)		probably null	Het
Cdh3	T	C	8: 107,270,871 (GRCm39)	V508A	probably benign	Het
Chrd	A	T	16: 20,554,822 (GRCm39)	I413F	probably benign	Het
Clec4b1	T	A	6: 123,048,494 (GRCm39)	*210R	probably null	Het
Col4a2	T	A	8: 11,448,651 (GRCm39)		probably null	Het
Gpx7	T	C	4: 108,260,512 (GRCm39)	T95A	probably benign	Het
Hivep3	T	A	4: 119,961,053 (GRCm39)		probably null	Het
Hrc	A	G	7: 44,985,128 (GRCm39)	Y93C	possibly damaging	Het
Igkv4-80	A	C	6: 68,993,649 (GRCm39)	S81A	probably benign	Het
Klhl5	G	T	5: 65,288,781 (GRCm39)	L14F	possibly damaging	Het
Mcm6	A	G	1: 128,261,375 (GRCm39)	L743P	probably benign	Het
Nrxn1	A	T	17: 90,469,792 (GRCm39)	F57Y	probably damaging	Het
Or51af1	C	T	7: 103,141,747 (GRCm39)	V113M	probably damaging	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Pcdh20	G	T	14: 88,706,351 (GRCm39)	D316E	probably damaging	Het
Pcdhb12	T	A	18: 37,569,142 (GRCm39)	V96E	probably damaging	Het
Pi4ka	A	T	16: 17,176,909 (GRCm39)	L346M	possibly damaging	Het
Pkhd1l1	A	C	15: 44,410,437 (GRCm39)	N2648T	possibly damaging	Het
Rufy1	C	T	11: 50,297,261 (GRCm39)	R397Q	probably damaging	Het
Sema5a	G	T	15: 32,686,793 (GRCm39)	M968I	probably benign	Het
Slc33a1	A	G	3: 63,871,167 (GRCm39)	Y149H	probably damaging	Het
Tln2	T	A	9: 67,261,764 (GRCm39)	R658S	probably benign	Het
Tmem30c	T	C	16: 57,090,385 (GRCm39)	N274S	possibly damaging	Het
Tor3a	A	G	1: 156,483,270 (GRCm39)	L384P	probably damaging	Het
Trpm3	T	A	19: 22,425,705 (GRCm39)	L20*	probably null	Het
Ttn	T	A	2: 76,560,556 (GRCm39)	I20955F	probably damaging	Het
Usp15	A	T	10: 122,949,545 (GRCm39)	S908R	probably benign	Het
Zfp866	A	G	8: 70,218,690 (GRCm39)	L310P	probably damaging	Het

Other mutations in Clock

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Clock	APN	5	76,377,311 (GRCm39)	missense	probably benign	0.17
IGL00725:Clock	APN	5	76,402,260 (GRCm39)	nonsense	probably null
IGL01304:Clock	APN	5	76,414,202 (GRCm39)	critical splice donor site	probably null
IGL01369:Clock	APN	5	76,384,933 (GRCm39)	missense	probably benign	0.30
IGL01542:Clock	APN	5	76,379,322 (GRCm39)	missense	possibly damaging	0.82
IGL02541:Clock	APN	5	76,410,519 (GRCm39)	splice site	probably null
IGL02602:Clock	APN	5	76,402,274 (GRCm39)	missense	probably damaging	1.00
IGL02602:Clock	APN	5	76,402,273 (GRCm39)	missense	probably null	1.00
IGL03186:Clock	APN	5	76,390,929 (GRCm39)	missense	probably damaging	0.98
IGL03309:Clock	APN	5	76,379,241 (GRCm39)	critical splice donor site	probably null
R6760_Clock_188	UTSW	5	76,374,823 (GRCm39)	missense	unknown
uhr	UTSW	5	76,377,401 (GRCm39)	nonsense	probably null
R0304:Clock	UTSW	5	76,374,832 (GRCm39)	missense	unknown
R0593:Clock	UTSW	5	76,413,683 (GRCm39)	missense	probably benign	0.25
R0654:Clock	UTSW	5	76,374,976 (GRCm39)	missense	possibly damaging	0.95
R0684:Clock	UTSW	5	76,393,365 (GRCm39)	missense	probably damaging	0.96
R0707:Clock	UTSW	5	76,374,976 (GRCm39)	missense	possibly damaging	0.95
R0751:Clock	UTSW	5	76,377,208 (GRCm39)	missense	possibly damaging	0.75
R0865:Clock	UTSW	5	76,414,271 (GRCm39)	splice site	probably benign
R0920:Clock	UTSW	5	76,378,167 (GRCm39)	missense	possibly damaging	0.80
R1396:Clock	UTSW	5	76,414,649 (GRCm39)	missense	probably benign	0.00
R1450:Clock	UTSW	5	76,410,578 (GRCm39)	nonsense	probably null
R1487:Clock	UTSW	5	76,414,201 (GRCm39)	splice site	probably null
R1574:Clock	UTSW	5	76,390,679 (GRCm39)	missense	probably damaging	1.00
R1574:Clock	UTSW	5	76,390,679 (GRCm39)	missense	probably damaging	1.00
R1858:Clock	UTSW	5	76,388,756 (GRCm39)	missense	possibly damaging	0.92
R1872:Clock	UTSW	5	76,396,309 (GRCm39)	missense	possibly damaging	0.67
R1905:Clock	UTSW	5	76,414,735 (GRCm39)	splice site	probably benign
R1937:Clock	UTSW	5	76,377,340 (GRCm39)	missense	probably damaging	0.99
R2411:Clock	UTSW	5	76,379,360 (GRCm39)	missense	probably benign	0.08
R2887:Clock	UTSW	5	76,393,120 (GRCm39)	missense	probably damaging	0.99
R3410:Clock	UTSW	5	76,377,401 (GRCm39)	nonsense	probably null
R4514:Clock	UTSW	5	76,378,046 (GRCm39)	missense	probably benign	0.00
R4598:Clock	UTSW	5	76,383,657 (GRCm39)	missense	probably benign	0.00
R4599:Clock	UTSW	5	76,383,657 (GRCm39)	missense	probably benign	0.00
R4795:Clock	UTSW	5	76,413,763 (GRCm39)	missense	probably damaging	1.00
R4796:Clock	UTSW	5	76,413,763 (GRCm39)	missense	probably damaging	1.00
R4973:Clock	UTSW	5	76,402,258 (GRCm39)	missense	possibly damaging	0.62
R5271:Clock	UTSW	5	76,389,801 (GRCm39)	missense	probably damaging	1.00
R5547:Clock	UTSW	5	76,378,185 (GRCm39)	missense	probably benign	0.02
R5630:Clock	UTSW	5	76,378,185 (GRCm39)	missense	probably benign	0.02
R5631:Clock	UTSW	5	76,378,185 (GRCm39)	missense	probably benign	0.02
R5632:Clock	UTSW	5	76,378,185 (GRCm39)	missense	probably benign	0.02
R5787:Clock	UTSW	5	76,384,898 (GRCm39)	missense	probably damaging	1.00
R6274:Clock	UTSW	5	76,385,000 (GRCm39)	missense	probably benign	0.45
R6578:Clock	UTSW	5	76,364,556 (GRCm39)	missense	unknown
R6622:Clock	UTSW	5	76,389,801 (GRCm39)	missense	probably damaging	1.00
R6760:Clock	UTSW	5	76,374,823 (GRCm39)	missense	unknown
R6793:Clock	UTSW	5	76,384,967 (GRCm39)	frame shift	probably null
R7406:Clock	UTSW	5	76,414,692 (GRCm39)	start codon destroyed	probably null	0.26
R7414:Clock	UTSW	5	76,410,611 (GRCm39)	missense	probably benign	0.00
R7560:Clock	UTSW	5	76,390,738 (GRCm39)	splice site	probably null
R7593:Clock	UTSW	5	76,384,145 (GRCm39)	missense	possibly damaging	0.80
R7640:Clock	UTSW	5	76,396,225 (GRCm39)	missense	possibly damaging	0.71
R7708:Clock	UTSW	5	76,414,256 (GRCm39)	missense	probably benign	0.00
R7713:Clock	UTSW	5	76,393,267 (GRCm39)	critical splice donor site	probably null
R7807:Clock	UTSW	5	76,390,982 (GRCm39)	missense	probably benign	0.01
R8171:Clock	UTSW	5	76,414,261 (GRCm39)	missense	possibly damaging	0.94
R8190:Clock	UTSW	5	76,375,051 (GRCm39)	missense	probably damaging	0.98
R8225:Clock	UTSW	5	76,389,759 (GRCm39)	missense	probably damaging	0.99
R8309:Clock	UTSW	5	76,402,269 (GRCm39)	missense	probably benign	0.07
R8557:Clock	UTSW	5	76,377,217 (GRCm39)	missense	probably damaging	1.00
R8792:Clock	UTSW	5	76,410,574 (GRCm39)	missense	probably damaging	1.00
R8869:Clock	UTSW	5	76,374,889 (GRCm39)	small deletion	probably benign
R8870:Clock	UTSW	5	76,383,632 (GRCm39)	missense	probably benign	0.17
R8980:Clock	UTSW	5	76,402,286 (GRCm39)	missense	probably benign	0.01
R8982:Clock	UTSW	5	76,364,559 (GRCm39)	missense	unknown
R9177:Clock	UTSW	5	76,377,256 (GRCm39)	missense	probably benign	0.00
R9208:Clock	UTSW	5	76,384,871 (GRCm39)	missense	probably benign	0.00
R9213:Clock	UTSW	5	76,393,376 (GRCm39)	missense	possibly damaging	0.94
R9307:Clock	UTSW	5	76,364,671 (GRCm39)	missense	unknown
R9446:Clock	UTSW	5	76,396,288 (GRCm39)	missense	probably benign	0.00
R9516:Clock	UTSW	5	76,377,227 (GRCm39)	missense	possibly damaging	0.85
R9572:Clock	UTSW	5	76,377,338 (GRCm39)	missense	probably benign	0.00
R9630:Clock	UTSW	5	76,393,281 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAGACAACATTCATTTGGAGAATGGG -3'
(R):5'- GGACTTCACAACTTCCAGACTAG -3'

Sequencing Primer
(F):5'- CGAGTCCATTACTGTCCA -3'
(R):5'- GACTAGCATTTTGTATCACCAGCTGG -3'

Posted On

2016-07-06