Incidental Mutation 'R5265:Ercc3'
ID401681
Institutional Source Beutler Lab
Gene Symbol Ercc3
Ensembl Gene ENSMUSG00000024382
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 3
SynonymsXPB
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32240300-32270151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32254243 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 503 (I503N)
Ref Sequence ENSEMBL: ENSMUSP00000025241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025241]
Predicted Effect probably damaging
Transcript: ENSMUST00000025241
AA Change: I503N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025241
Gene: ENSMUSG00000024382
AA Change: I503N

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:Helicase_C_3 76 203 1.2e-46 PFAM
DEXDc 313 493 2.52e-18 SMART
HELICc 570 648 4.32e-8 SMART
low complexity region 707 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142213
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ATP-dependent DNA helicase that functions in nucleotide excision repair. The encoded protein is a subunit of basal transcription factor 2 (TFIIH) and, therefore, also functions in class II transcription. Mutations in this gene are associated with Xeroderma pigmentosum B, Cockayne's syndrome, and trichothiodystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a frame shift mutation in exon 15 exhibit embryonic lethality prior to E8.5. Mice homozygous for a frame shift mutation following by a stop codon insertion in exon 15 exhibit increased sensitivity to ultraviolet- and gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Ercc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Ercc3 APN 18 32264545 splice site probably benign
IGL01108:Ercc3 APN 18 32264585 missense probably damaging 0.99
IGL01131:Ercc3 APN 18 32269889 makesense probably null
IGL01541:Ercc3 APN 18 32248319 missense possibly damaging 0.87
IGL01959:Ercc3 APN 18 32257358 missense probably damaging 1.00
IGL02862:Ercc3 APN 18 32243202 critical splice donor site probably null
IGL03107:Ercc3 APN 18 32248307 missense possibly damaging 0.95
IGL03334:Ercc3 APN 18 32240837 critical splice donor site probably null
PIT4651001:Ercc3 UTSW 18 32240312 unclassified probably benign
R0545:Ercc3 UTSW 18 32245902 missense probably damaging 1.00
R0561:Ercc3 UTSW 18 32245539 missense possibly damaging 0.85
R1159:Ercc3 UTSW 18 32264558 missense possibly damaging 0.86
R1496:Ercc3 UTSW 18 32261297 splice site probably benign
R1733:Ercc3 UTSW 18 32267165 missense possibly damaging 0.60
R1943:Ercc3 UTSW 18 32246610 missense probably damaging 1.00
R2013:Ercc3 UTSW 18 32248429 missense probably benign
R2015:Ercc3 UTSW 18 32248429 missense probably benign
R2303:Ercc3 UTSW 18 32245547 missense probably benign 0.08
R4393:Ercc3 UTSW 18 32265621 missense probably benign 0.00
R4600:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4601:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4602:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4603:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4796:Ercc3 UTSW 18 32248310 missense probably damaging 1.00
R4957:Ercc3 UTSW 18 32243117 missense probably damaging 1.00
R5253:Ercc3 UTSW 18 32269864 missense probably damaging 0.97
R5342:Ercc3 UTSW 18 32245595 missense probably benign 0.01
R5455:Ercc3 UTSW 18 32267209 missense possibly damaging 0.89
R5639:Ercc3 UTSW 18 32265714 missense probably damaging 0.99
R5702:Ercc3 UTSW 18 32254153 missense probably damaging 0.99
R6026:Ercc3 UTSW 18 32245921 critical splice donor site probably null
R6053:Ercc3 UTSW 18 32246754 missense probably damaging 1.00
R6650:Ercc3 UTSW 18 32261336 missense probably damaging 1.00
R7150:Ercc3 UTSW 18 32257272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTTGCAGCCAGGATGTTC -3'
(R):5'- CTTGCTGCCTTAACCACATG -3'

Sequencing Primer
(F):5'- TTCCGGCGGGTTCTGAC -3'
(R):5'- CAGAGAATTCCAGTGCGGTCTG -3'
Posted On2016-07-06