Incidental Mutation 'R5282:Gabrg2'
ID402827
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Synonymsgamma2, Gabrg-2, GABAA-R
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location41910203-42000857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41971732 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 175 (G175D)
Ref Sequence ENSEMBL: ENSMUSP00000063812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
Predicted Effect probably damaging
Transcript: ENSMUST00000070725
AA Change: G175D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: G175D

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070735
AA Change: G175D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: G175D

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109290
AA Change: G175D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: G175D

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155032
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41971772 missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41912522 missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41971721 missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41912393 missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41916315 missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41976663 missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41920470 missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41971908 missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41976636 missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41971880 missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41968823 missense probably damaging 1.00
R4869:Gabrg2 UTSW 11 41920404 missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41976558 missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41967623 missense probably damaging 1.00
R5876:Gabrg2 UTSW 11 41968820 missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 42000523 unclassified probably null
R6300:Gabrg2 UTSW 11 42000523 unclassified probably null
R6315:Gabrg2 UTSW 11 41971861 missense probably damaging 0.99
X0065:Gabrg2 UTSW 11 41912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCTAGAGCCAAGTTCATAGTC -3'
(R):5'- ACCTGGTATGACAGACGTTTG -3'

Sequencing Primer
(F):5'- AGAGCCAAGTTCATAGTCATATACC -3'
(R):5'- CAGACGTTTGAAATTTAACAGTACC -3'
Posted On2016-07-22