Incidental Mutation 'R5408:Mapk3'
ID426392
Institutional Source Beutler Lab
Gene Symbol Mapk3
Ensembl Gene ENSMUSG00000063065
Gene Namemitogen-activated protein kinase 3
Synonymsp44erk1, p44mapk, Prkm3, p44 MAP kinase, Mtap2k, Erk1, Esrk1, Erk-1
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126759601-126765819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126763835 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 253 (D253G)
Ref Sequence ENSEMBL: ENSMUSP00000101969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032944] [ENSMUST00000050201] [ENSMUST00000057669] [ENSMUST00000091328]
Predicted Effect probably benign
Transcript: ENSMUST00000032944
SMART Domains Protein: ENSMUSP00000032944
Gene: ENSMUSG00000030703

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:GDPD 44 202 1.1e-23 PFAM
low complexity region 208 216 N/A INTRINSIC
low complexity region 311 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050201
AA Change: D253G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101969
Gene: ENSMUSG00000063065
AA Change: D253G

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Predicted Effect unknown
Transcript: ENSMUST00000057669
AA Change: D253G
SMART Domains Protein: ENSMUSP00000051619
Gene: ENSMUSG00000063065
AA Change: D253G

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Blast:S_TKc 335 372 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000091328
AA Change: D138G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088880
Gene: ENSMUSG00000063065
AA Change: D138G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 213 2.5e-24 PFAM
Pfam:Pkinase 1 216 2.2e-58 PFAM
Pfam:APH 17 108 7.6e-7 PFAM
Blast:S_TKc 220 257 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205468
Predicted Effect unknown
Transcript: ENSMUST00000205657
AA Change: D251G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205910
Predicted Effect unknown
Transcript: ENSMUST00000206272
AA Change: D150G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207004
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are hyperactive with impaired T cell maturation and proliferation. Mice homozygous for a knock-out allele on a CD-1 background exhibit normal Mendelian ratios, growth, and no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Mapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mapk3 APN 7 126764774 nonsense probably null
IGL02412:Mapk3 APN 7 126763038 nonsense probably null
wabasha UTSW 7 126763512 nonsense probably null
R0078:Mapk3 UTSW 7 126759805 missense probably damaging 1.00
R0532:Mapk3 UTSW 7 126763386 intron probably benign
R1549:Mapk3 UTSW 7 126763512 nonsense probably null
R2913:Mapk3 UTSW 7 126760806 nonsense probably null
R5220:Mapk3 UTSW 7 126764236 missense probably benign
R5729:Mapk3 UTSW 7 126764807 missense probably benign 0.01
R5929:Mapk3 UTSW 7 126759858 unclassified probably benign
R6307:Mapk3 UTSW 7 126764282 missense probably benign 0.03
R6359:Mapk3 UTSW 7 126760756 missense probably benign
R7356:Mapk3 UTSW 7 126760915 critical splice donor site probably null
R7380:Mapk3 UTSW 7 126764795 missense
R7384:Mapk3 UTSW 7 126764291 missense
X0017:Mapk3 UTSW 7 126764248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGAGTAGAGTTTTCCTCGGCTC -3'
(R):5'- TTCTCAGGGGTACGGCTTAG -3'

Sequencing Primer
(F):5'- AGATCTAAGTTGGATATGGTGCC -3'
(R):5'- GCTTAGCCTTGCTTTCCCCAG -3'
Posted On2016-09-01