Incidental Mutation 'R5408:Dctn6'
ID426393
Institutional Source Beutler Lab
Gene Symbol Dctn6
Ensembl Gene ENSMUSG00000031516
Gene Namedynactin 6
SynonymsWS-3, p27
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location34090420-34108796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34094902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 89 (V89I)
Ref Sequence ENSEMBL: ENSMUSP00000033913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033913] [ENSMUST00000117243] [ENSMUST00000118811] [ENSMUST00000143411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033913
AA Change: V89I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033913
Gene: ENSMUSG00000031516
AA Change: V89I

DomainStartEndE-ValueType
Pfam:Hexapep 8 43 3.3e-5 PFAM
Pfam:Hexapep 98 133 3.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117243
AA Change: V94I

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113716
Gene: ENSMUSG00000031516
AA Change: V94I

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
Pfam:Hexapep 103 138 2.2e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118811
AA Change: V84I

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113280
Gene: ENSMUSG00000031516
AA Change: V84I

DomainStartEndE-ValueType
Pfam:Hexapep 3 38 4.7e-6 PFAM
Pfam:Hexapep 93 128 5.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142661
Predicted Effect probably benign
Transcript: ENSMUST00000143411
SMART Domains Protein: ENSMUSP00000117109
Gene: ENSMUSG00000031516

DomainStartEndE-ValueType
PDB:3TV0|B 1 103 3e-35 PDB
Predicted Effect unknown
Transcript: ENSMUST00000152422
AA Change: V70I
SMART Domains Protein: ENSMUSP00000120022
Gene: ENSMUSG00000031516
AA Change: V70I

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Hexapep 80 115 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181097
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Dctn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Dctn6 APN 8 34092593 missense probably damaging 1.00
R2292:Dctn6 UTSW 8 34092525 missense probably benign 0.03
R4868:Dctn6 UTSW 8 34092076 unclassified probably benign
R5460:Dctn6 UTSW 8 34104981 splice site probably null
R5862:Dctn6 UTSW 8 34108417 critical splice donor site probably null
R6265:Dctn6 UTSW 8 34094903 missense probably damaging 1.00
R7256:Dctn6 UTSW 8 34090808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTCTTTCCTAGAAAAGAGC -3'
(R):5'- GACAGCTGATTCAGATTCTGTTTTG -3'

Sequencing Primer
(F):5'- GATCCCCTCAGATTGAAGTTGCAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2016-09-01