Incidental Mutation 'R5428:Plag1'
ID426998
Institutional Source Beutler Lab
Gene Symbol Plag1
Ensembl Gene ENSMUSG00000003282
Gene Namepleiomorphic adenoma gene 1
Synonyms
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3900996-3938423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3905538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 51 (V51I)
Ref Sequence ENSEMBL: ENSMUSP00000003369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003369] [ENSMUST00000137439] [ENSMUST00000151543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003369
AA Change: V51I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003369
Gene: ENSMUSG00000003282
AA Change: V51I

DomainStartEndE-ValueType
ZnF_C2H2 34 56 2.2e-2 SMART
ZnF_C2H2 62 86 1.6e-4 SMART
ZnF_C2H2 92 114 1.89e-1 SMART
ZnF_C2H2 121 143 5.99e-4 SMART
ZnF_C2H2 150 172 2.86e-1 SMART
ZnF_C2H2 185 207 1.03e-2 SMART
ZnF_C2H2 213 236 8.94e-3 SMART
low complexity region 364 379 N/A INTRINSIC
low complexity region 396 411 N/A INTRINSIC
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137439
Predicted Effect probably benign
Transcript: ENSMUST00000151543
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced male fertility, small seminal vesicles and ventral prostate, reduced litter size (females only), reduced embryonic and postnatal growth, and delayed eyelid opening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Plag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Plag1 APN 4 3904055 missense probably damaging 0.99
IGL01775:Plag1 APN 4 3904513 missense probably damaging 1.00
IGL02738:Plag1 APN 4 3903812 nonsense probably null
rehab UTSW 4 3904546 missense probably damaging 1.00
scrawny UTSW 4 3905463 nonsense probably null
PIT4378001:Plag1 UTSW 4 3905492 missense probably benign 0.16
R0217:Plag1 UTSW 4 3904379 missense probably benign 0.05
R0359:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0554:Plag1 UTSW 4 3904546 missense probably damaging 1.00
R0892:Plag1 UTSW 4 3904532 nonsense probably null
R1541:Plag1 UTSW 4 3904085 missense probably benign
R1964:Plag1 UTSW 4 3903956 missense probably benign
R2011:Plag1 UTSW 4 3904889 missense probably damaging 1.00
R2012:Plag1 UTSW 4 3904870 missense probably damaging 1.00
R2126:Plag1 UTSW 4 3904169 missense possibly damaging 0.50
R3982:Plag1 UTSW 4 3904055 missense probably damaging 0.97
R4285:Plag1 UTSW 4 3905654 missense probably benign 0.13
R5244:Plag1 UTSW 4 3903887 missense probably benign 0.02
R5289:Plag1 UTSW 4 3905545 missense probably damaging 1.00
R5386:Plag1 UTSW 4 3904075 missense probably benign
R5608:Plag1 UTSW 4 3905463 nonsense probably null
R5755:Plag1 UTSW 4 3904492 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6036:Plag1 UTSW 4 3904618 missense possibly damaging 0.94
R6080:Plag1 UTSW 4 3903815 missense probably benign
R6296:Plag1 UTSW 4 3904499 missense probably damaging 1.00
R7038:Plag1 UTSW 4 3904676 missense probably damaging 1.00
R7116:Plag1 UTSW 4 3904812 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAACATTTCCTCTCTGCAAATCAGCTG -3'
(R):5'- TCCCAGGTGTCCAACAAGAAG -3'

Sequencing Primer
(F):5'- TCTGCAAATCAGCTGAGAAATGTG -3'
(R):5'- TCCAACAAGAAGGCCTGGTTTAG -3'
Posted On2016-09-01