Incidental Mutation 'R5450:Slc30a5'
ID429298
Institutional Source Beutler Lab
Gene Symbol Slc30a5
Ensembl Gene ENSMUSG00000021629
Gene Namesolute carrier family 30 (zinc transporter), member 5
SynonymsZntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100802648-100833427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100821172 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 130 (V130I)
Ref Sequence ENSEMBL: ENSMUSP00000065764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067246
AA Change: V130I

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: V130I

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
transmembrane domain 56 75 N/A INTRINSIC
transmembrane domain 96 113 N/A INTRINSIC
transmembrane domain 128 145 N/A INTRINSIC
transmembrane domain 150 164 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
transmembrane domain 235 254 N/A INTRINSIC
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 341 360 N/A INTRINSIC
Pfam:Cation_efflux 417 645 1.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224177
Predicted Effect possibly damaging
Transcript: ENSMUST00000225922
AA Change: V130I

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Slc30a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Slc30a5 APN 13 100806666 missense probably damaging 1.00
IGL01647:Slc30a5 APN 13 100821145 missense possibly damaging 0.66
IGL02338:Slc30a5 APN 13 100803433 missense probably damaging 0.99
IGL02408:Slc30a5 APN 13 100813724 missense probably damaging 1.00
IGL02582:Slc30a5 APN 13 100812647 critical splice donor site probably null
IGL02987:Slc30a5 APN 13 100803915 missense probably damaging 1.00
IGL03025:Slc30a5 APN 13 100813887 missense probably damaging 0.99
IGL03064:Slc30a5 APN 13 100811310 missense probably damaging 1.00
IGL03089:Slc30a5 APN 13 100813830 missense probably benign 0.01
IGL03268:Slc30a5 APN 13 100806703 missense probably damaging 1.00
R0083:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0153:Slc30a5 UTSW 13 100826494 missense possibly damaging 0.46
R0542:Slc30a5 UTSW 13 100809285 splice site probably null
R0601:Slc30a5 UTSW 13 100814770 intron probably benign
R1125:Slc30a5 UTSW 13 100803413 missense probably damaging 1.00
R1434:Slc30a5 UTSW 13 100803442 missense probably damaging 0.98
R1673:Slc30a5 UTSW 13 100813383 missense probably benign 0.13
R1762:Slc30a5 UTSW 13 100813462 missense probably damaging 1.00
R1974:Slc30a5 UTSW 13 100813953 missense probably benign 0.06
R2082:Slc30a5 UTSW 13 100806533 critical splice donor site probably null
R2151:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2152:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2153:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R3899:Slc30a5 UTSW 13 100818147 missense probably benign 0.18
R4009:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4010:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4270:Slc30a5 UTSW 13 100829013 missense probably benign 0.04
R4815:Slc30a5 UTSW 13 100813710 missense probably damaging 1.00
R5048:Slc30a5 UTSW 13 100806741 missense probably damaging 1.00
R5638:Slc30a5 UTSW 13 100813872 nonsense probably null
R5892:Slc30a5 UTSW 13 100813302 missense probably damaging 1.00
R5911:Slc30a5 UTSW 13 100809092 missense probably damaging 1.00
R6453:Slc30a5 UTSW 13 100814689 missense probably benign 0.00
R6769:Slc30a5 UTSW 13 100813860 missense probably benign 0.19
R6795:Slc30a5 UTSW 13 100817069 missense probably damaging 1.00
R7020:Slc30a5 UTSW 13 100824913 splice site probably null
R7224:Slc30a5 UTSW 13 100809254 missense probably damaging 0.99
R7305:Slc30a5 UTSW 13 100811424 missense probably damaging 0.98
R7318:Slc30a5 UTSW 13 100813969 missense probably benign 0.13
X0019:Slc30a5 UTSW 13 100813842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGCAGAGGCATTTATACAATC -3'
(R):5'- GCCAATACTAAAATGTTCTCCAAGG -3'

Sequencing Primer
(F):5'- AAGTACACTGTAGCTGTCTCCAG -3'
(R):5'- AAATGTTCTCCAAGGAATTGTCC -3'
Posted On2016-09-06