Incidental Mutation 'R5477:Hs2st1'
ID434110
Institutional Source Beutler Lab
Gene Symbol Hs2st1
Ensembl Gene ENSMUSG00000040151
Gene Nameheparan sulfate 2-O-sulfotransferase 1
SynonymsHs2st
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144429706-144570181 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to G at 144556948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043325] [ENSMUST00000160690]
Predicted Effect probably benign
Transcript: ENSMUST00000043325
SMART Domains Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
Pfam:Sulfotransfer_2 66 327 9.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160690
SMART Domains Protein: ENSMUSP00000123816
Gene: ENSMUSG00000040151

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Zfp715 T C 7: 43,299,954 Y194C probably damaging Het
Other mutations in Hs2st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0037:Hs2st1 UTSW 3 144437644 nonsense probably null
R1215:Hs2st1 UTSW 3 144465141 missense possibly damaging 0.75
R1450:Hs2st1 UTSW 3 144434718 splice site probably benign
R1474:Hs2st1 UTSW 3 144435495 missense possibly damaging 0.94
R1505:Hs2st1 UTSW 3 144434561 missense probably benign 0.19
R1695:Hs2st1 UTSW 3 144434654 missense probably benign 0.00
R2511:Hs2st1 UTSW 3 144569930 unclassified probably benign
R2967:Hs2st1 UTSW 3 144465138 missense probably damaging 1.00
R3928:Hs2st1 UTSW 3 144434628 missense possibly damaging 0.55
R4895:Hs2st1 UTSW 3 144465253 missense probably benign
R4911:Hs2st1 UTSW 3 144465082 missense probably benign 0.23
R5666:Hs2st1 UTSW 3 144569793 missense probably damaging 0.97
R6262:Hs2st1 UTSW 3 144434613 missense probably damaging 0.96
X0019:Hs2st1 UTSW 3 144454012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTAAGGAGTCCAAACTAGCCC -3'
(R):5'- TAGCTGAAAGTCACTCGGC -3'

Sequencing Primer
(F):5'- GAGTCCAAACTAGCCCACTGGG -3'
(R):5'- CGGGAGTGATTTGCCACAAAGC -3'
Posted On2016-10-06