Incidental Mutation 'R5590:Ttc39a'
ID437412
Institutional Source Beutler Lab
Gene Symbol Ttc39a
Ensembl Gene ENSMUSG00000028555
Gene Nametetratricopeptide repeat domain 39A
Synonyms4922503N01Rik
MMRRC Submission 043143-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5590 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109406623-109444745 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 109432987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064129] [ENSMUST00000106618] [ENSMUST00000124209] [ENSMUST00000153315]
Predicted Effect probably null
Transcript: ENSMUST00000064129
SMART Domains Protein: ENSMUSP00000066334
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
TPR 278 311 7.69e1 SMART
TPR 468 501 6.57e1 SMART
TPR 509 542 1.42e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106618
SMART Domains Protein: ENSMUSP00000102229
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
TPR 280 313 7.69e1 SMART
TPR 470 503 6.57e1 SMART
TPR 511 544 1.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124209
SMART Domains Protein: ENSMUSP00000118672
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
Pfam:DUF3808 1 137 6.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153315
SMART Domains Protein: ENSMUSP00000117621
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
Pfam:DUF3808 1 160 2.6e-53 PFAM
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (108/108)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,472 S189P possibly damaging Het
3100002H09Rik T G 4: 124,610,487 M91L unknown Het
A2m C T 6: 121,676,932 T1408M probably damaging Het
Abca16 C T 7: 120,544,772 T1671M probably damaging Het
Adamts8 A T 9: 30,951,336 N279I probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Aldh4a1 T A 4: 139,642,104 V322E probably damaging Het
Atp12a A T 14: 56,373,380 Y327F probably benign Het
C4b T C 17: 34,740,335 T422A probably damaging Het
Cacna1c A T 6: 118,687,182 S668T probably damaging Het
Cchcr1 A T 17: 35,526,680 E426D probably damaging Het
Ccr3 G A 9: 124,028,793 G55D probably damaging Het
Cdipt T A 7: 126,979,532 probably null Het
Cep19 A G 16: 32,103,898 probably benign Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cyp3a11 C A 5: 145,865,977 M235I probably benign Het
Dnajc21 A T 15: 10,462,277 D87E possibly damaging Het
Ell A C 8: 70,539,707 M1L possibly damaging Het
Esyt3 T C 9: 99,358,413 probably benign Het
Ets1 T C 9: 32,728,798 probably benign Het
Fam222b T A 11: 78,155,032 M473K probably benign Het
Fanca T C 8: 123,303,963 probably benign Het
Fbrsl1 G T 5: 110,381,618 A67D probably damaging Het
Fchsd1 G A 18: 37,961,327 P622L probably damaging Het
Gal3st2c T G 1: 94,008,301 probably null Het
Gins2 T G 8: 120,581,747 H166P possibly damaging Het
Gm10118 A T 10: 63,927,066 probably benign Het
Gm9979 A T 13: 40,705,813 noncoding transcript Het
Hspbap1 A G 16: 35,801,663 Y126C probably damaging Het
Hspd1 A T 1: 55,084,769 I64N probably damaging Het
Igkv3-4 A T 6: 70,672,283 S89C probably damaging Het
Il10ra T A 9: 45,265,626 K134* probably null Het
Il12rb1 G A 8: 70,813,767 C252Y possibly damaging Het
Il24 A T 1: 130,882,516 V201E possibly damaging Het
Inpp1 A G 1: 52,794,661 I92T probably damaging Het
Kcnh5 T C 12: 74,976,689 D535G probably benign Het
Kcnq4 T A 4: 120,715,885 I240F probably damaging Het
Kctd17 G A 15: 78,437,302 probably benign Het
Leo1 T A 9: 75,457,141 I521N possibly damaging Het
Mdga1 A G 17: 29,839,867 L722P probably damaging Het
Met G T 6: 17,548,782 V942L probably benign Het
Mfn1 A T 3: 32,563,847 T110S probably benign Het
Mrps15 T C 4: 126,048,695 I79T probably benign Het
Mycbp2 A C 14: 103,123,355 M4497R probably damaging Het
Mylk T A 16: 34,879,352 S362T probably benign Het
Mypn A G 10: 63,120,048 F1209L probably benign Het
Nab2 T C 10: 127,664,657 S189G probably damaging Het
Naxe A C 3: 88,056,533 probably null Het
Ncf1 A G 5: 134,223,501 V232A probably damaging Het
Nell1 A G 7: 50,279,611 Y422C probably damaging Het
Nmnat2 G T 1: 153,094,061 G176V probably damaging Het
Npr1 A G 3: 90,454,842 S999P probably damaging Het
Nuak1 T C 10: 84,375,255 D323G probably benign Het
Olfr1424 A G 19: 12,059,278 V158A probably benign Het
Olfr191 A G 16: 59,085,997 F162S probably benign Het
Olfr918 T A 9: 38,672,965 T160S probably damaging Het
Osbpl8 T C 10: 111,272,168 S342P probably damaging Het
Pag1 A T 3: 9,699,422 Y224N probably damaging Het
Pald1 T A 10: 61,343,710 H460L probably damaging Het
Per2 G A 1: 91,427,856 Q727* probably null Het
Pex19 T C 1: 172,133,212 V134A probably benign Het
Phlpp1 A T 1: 106,392,927 I1551F possibly damaging Het
Ppef2 A T 5: 92,239,139 V313D probably damaging Het
Pzp A C 6: 128,523,796 F153C probably damaging Het
Rasl11a A G 5: 146,845,242 H9R probably benign Het
Rfx3 A T 19: 27,802,380 probably null Het
Rmnd5b A T 11: 51,627,962 I68N probably damaging Het
Senp5 T A 16: 31,989,513 S281C probably damaging Het
Sh3rf1 G A 8: 61,361,732 E442K probably benign Het
Slc12a3 G A 8: 94,345,788 V645M probably damaging Het
Slc22a16 T C 10: 40,581,341 F193L possibly damaging Het
Slc35f1 A T 10: 53,108,178 T345S possibly damaging Het
Slc9a1 G A 4: 133,421,563 R704H probably damaging Het
Spta1 A T 1: 174,175,770 Y89F possibly damaging Het
Sspo A G 6: 48,474,491 E2741G probably damaging Het
Strn4 G A 7: 16,833,874 probably null Het
Tanc2 A G 11: 105,923,306 T1859A probably damaging Het
Tbc1d14 A T 5: 36,525,045 Y3N probably damaging Het
Tdrd9 C A 12: 112,051,980 R1278S probably benign Het
Tenm4 G T 7: 96,797,400 A826S possibly damaging Het
Tenm4 C A 7: 96,797,401 A826E possibly damaging Het
Tet2 C T 3: 133,476,480 probably null Het
Tfec A G 6: 16,834,200 L236P probably benign Het
Tjap1 A G 17: 46,258,871 S388P probably damaging Het
Tle1 T C 4: 72,124,971 T554A possibly damaging Het
Tmem17 G A 11: 22,517,450 V83I probably benign Het
Tnrc6b C T 15: 80,876,502 H137Y probably damaging Het
Tomm5 T C 4: 45,106,679 probably benign Het
Top3b T A 16: 16,891,577 probably benign Het
Tph1 T C 7: 46,653,792 H254R probably damaging Het
Tpte T C 8: 22,351,452 Y487H probably damaging Het
Trappc13 T A 13: 104,148,241 D241V probably damaging Het
Trrap A G 5: 144,782,265 I193V probably benign Het
Tspear A T 10: 77,870,365 H323L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubg1 A G 11: 101,124,032 D200G probably damaging Het
Ugdh C A 5: 65,422,874 probably benign Het
Uso1 A G 5: 92,180,608 N355D probably benign Het
Vamp4 T C 1: 162,592,679 probably null Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vps52 A G 17: 33,961,221 T300A probably benign Het
Wt1 A T 2: 105,127,284 H163L probably damaging Het
Xirp2 T C 2: 67,514,035 S2207P probably benign Het
Xpo6 A T 7: 126,107,078 I30N probably damaging Het
Zfp386 T A 12: 116,059,727 I320K probably benign Het
Other mutations in Ttc39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Ttc39a APN 4 109442345 splice site probably benign
IGL01143:Ttc39a APN 4 109442813 critical splice donor site probably null
IGL01802:Ttc39a APN 4 109433084 nonsense probably null
IGL01906:Ttc39a APN 4 109421394 missense probably benign 0.04
IGL02115:Ttc39a APN 4 109426294 splice site probably benign
IGL02415:Ttc39a APN 4 109431529 unclassified probably benign
IGL02658:Ttc39a APN 4 109422893 missense probably damaging 1.00
IGL02728:Ttc39a APN 4 109442723 missense probably damaging 1.00
IGL03281:Ttc39a APN 4 109433022 missense possibly damaging 0.84
R0030:Ttc39a UTSW 4 109422973 missense probably benign
R0103:Ttc39a UTSW 4 109421453 intron probably null
R0194:Ttc39a UTSW 4 109444179 missense probably benign
R0561:Ttc39a UTSW 4 109440602 missense probably damaging 1.00
R0603:Ttc39a UTSW 4 109426302 missense probably damaging 1.00
R2132:Ttc39a UTSW 4 109442706 missense probably damaging 1.00
R2203:Ttc39a UTSW 4 109431588 missense probably benign 0.19
R2473:Ttc39a UTSW 4 109442239 missense probably damaging 0.97
R4449:Ttc39a UTSW 4 109442303 missense possibly damaging 0.82
R4809:Ttc39a UTSW 4 109416021 nonsense probably null
R5266:Ttc39a UTSW 4 109422504 missense probably benign 0.04
R5911:Ttc39a UTSW 4 109422971 missense possibly damaging 0.79
R5930:Ttc39a UTSW 4 109430878 missense probably benign
R7058:Ttc39a UTSW 4 109431566 missense probably damaging 1.00
X0013:Ttc39a UTSW 4 109433137 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTCCCAGGCTGTCCTATG -3'
(R):5'- GGACAAATCTGTGTTCAGTCAGGG -3'

Sequencing Primer
(F):5'- AGGCTGTCCTATGGGGGC -3'
(R):5'- TGACCCACAGTGTCAGCTTAC -3'
Posted On2016-10-26