Incidental Mutation 'R5641:Il21'
ID440656
Institutional Source Beutler Lab
Gene Symbol Il21
Ensembl Gene ENSMUSG00000027718
Gene Nameinterleukin 21
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5641 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37222759-37232636 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 37227768 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 76 (K76*)
Ref Sequence ENSEMBL: ENSMUSP00000124668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]
Predicted Effect probably null
Transcript: ENSMUST00000029273
AA Change: K76*
SMART Domains Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: K76*

DomainStartEndE-ValueType
Pfam:IL15 4 142 7.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147691
Predicted Effect probably null
Transcript: ENSMUST00000161015
AA Change: K76*
SMART Domains Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: K76*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
PDB:3TGX|P 39 140 8e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196943
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,472,013 M1398L probably benign Het
Acad12 A G 5: 121,604,021 probably benign Het
Aldh1a7 T C 19: 20,715,929 I209V probably benign Het
Alkal2 G A 12: 30,887,265 probably null Het
Aqr A G 2: 114,149,034 F307L probably damaging Het
Atp2a2 A G 5: 122,457,576 L932P probably damaging Het
Atxn7 T C 14: 14,013,638 M113T probably damaging Het
Blzf1 T A 1: 164,306,469 M4L probably benign Het
Brca2 C A 5: 150,556,899 S2711R probably damaging Het
Bzw1 A T 1: 58,397,724 Q70L probably damaging Het
Cd34 T A 1: 194,947,968 I70N probably benign Het
Chac1 A G 2: 119,351,518 Y39C probably damaging Het
Col6a2 G C 10: 76,613,278 P275A probably damaging Het
Crb1 T A 1: 139,248,889 N452I probably damaging Het
Ctrc T C 4: 141,838,783 N188S probably damaging Het
Dnah7b G A 1: 46,268,764 probably null Het
Etl4 GGGGAAGAACCGG GGG 2: 20,806,462 probably null Het
Exoc6 T A 19: 37,587,633 probably null Het
Gm5616 T A 9: 48,450,416 noncoding transcript Het
Gm7535 T C 17: 17,911,526 probably benign Het
Hnrnpr T C 4: 136,332,487 S200P probably damaging Het
Ighg2b T C 12: 113,307,147 N121S unknown Het
Jup T A 11: 100,376,806 T564S possibly damaging Het
Kcns2 G C 15: 34,839,053 R187S possibly damaging Het
Klhl18 G A 9: 110,446,828 T84M probably damaging Het
Mtor T A 4: 148,546,425 L2280M probably damaging Het
Ncoa6 A G 2: 155,421,836 I226T probably benign Het
Nipbl A T 15: 8,366,712 Y126N possibly damaging Het
Nlrp4a T A 7: 26,450,164 C399S probably damaging Het
Nphp3 A G 9: 104,036,153 K54E probably damaging Het
Nsun2 T A 13: 69,623,249 V326E probably benign Het
Olfr725 A G 14: 50,035,289 I38T probably benign Het
Oosp3 T C 19: 11,697,173 probably null Het
Pcdhga9 T C 18: 37,738,248 S377P probably damaging Het
Pdlim3 A G 8: 45,915,263 probably null Het
Pla2r1 A T 2: 60,514,984 W343R probably damaging Het
Prox2 A G 12: 85,087,947 V520A probably benign Het
Rfx3 T C 19: 27,793,608 probably null Het
Rif1 A C 2: 52,121,158 R2412S possibly damaging Het
Rreb1 T C 13: 37,947,421 L1517P probably benign Het
Rxfp1 T C 3: 79,686,892 N65S probably damaging Het
Sbf2 T C 7: 110,438,901 E399G probably damaging Het
Slc36a4 A C 9: 15,728,802 probably null Het
Slco1a1 A T 6: 141,939,969 M110K probably damaging Het
Stat5a T A 11: 100,876,808 C401S probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem150c T C 5: 100,083,664 T151A probably damaging Het
Ube4a A T 9: 44,950,881 M173K probably damaging Het
Vmn1r188 A T 13: 22,088,172 S99C probably damaging Het
Vmn2r70 C T 7: 85,559,364 C635Y probably damaging Het
Zfp644 T C 5: 106,619,595 K24E probably damaging Het
Other mutations in Il21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0433:Il21 UTSW 3 37232535 missense possibly damaging 0.46
R0579:Il21 UTSW 3 37227774 missense possibly damaging 0.65
R1641:Il21 UTSW 3 37232532 missense probably benign 0.00
R1741:Il21 UTSW 3 37227662 missense probably benign 0.00
R1754:Il21 UTSW 3 37225525 missense possibly damaging 0.93
R1933:Il21 UTSW 3 37232486 missense probably benign
R4560:Il21 UTSW 3 37225484 nonsense probably null
R4975:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4977:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4979:Il21 UTSW 3 37232504 missense probably damaging 0.99
R5254:Il21 UTSW 3 37227735 missense possibly damaging 0.94
R5267:Il21 UTSW 3 37227797 missense probably benign
R7058:Il21 UTSW 3 37232480 missense probably damaging 1.00
R7259:Il21 UTSW 3 37227654 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTATGTTACAACTAACGGGTAAGAC -3'
(R):5'- TGACCAGACCTAATGGAGCC -3'

Sequencing Primer
(F):5'- GTTACAACTAACGGGTAAGACTTATC -3'
(R):5'- GGGCTGGAATGTCATTTTC -3'
Posted On2016-11-08