Incidental Mutation 'R5657:Cyb561d1'
ID442369
Institutional Source Beutler Lab
Gene Symbol Cyb561d1
Ensembl Gene ENSMUSG00000048796
Gene Namecytochrome b-561 domain containing 1
Synonyms
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108195687-108201212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108200692 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 28 (I28T)
Ref Sequence ENSEMBL: ENSMUSP00000102266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065664] [ENSMUST00000102633] [ENSMUST00000106654] [ENSMUST00000106655] [ENSMUST00000117409] [ENSMUST00000117784] [ENSMUST00000119650]
Predicted Effect probably benign
Transcript: ENSMUST00000065664
SMART Domains Protein: ENSMUSP00000070361
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102633
SMART Domains Protein: ENSMUSP00000099693
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 198 265 3.9e-29 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106654
SMART Domains Protein: ENSMUSP00000102265
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106655
AA Change: I28T

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102266
Gene: ENSMUSG00000048796
AA Change: I28T

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
B561 54 185 4.96e-47 SMART
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117409
SMART Domains Protein: ENSMUSP00000112976
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 164 235 1.2e-31 PFAM
low complexity region 301 320 N/A INTRINSIC
low complexity region 324 331 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117784
SMART Domains Protein: ENSMUSP00000114031
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 196 267 1.6e-31 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119650
SMART Domains Protein: ENSMUSP00000113020
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
Pfam:SCA7 161 232 1.2e-31 PFAM
low complexity region 298 317 N/A INTRINSIC
low complexity region 321 328 N/A INTRINSIC
low complexity region 400 417 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155099
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Cyb561d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Cyb561d1 APN 3 108199627 missense probably damaging 1.00
IGL02996:Cyb561d1 APN 3 108199645 missense probably damaging 1.00
R0681:Cyb561d1 UTSW 3 108199267 missense probably benign 0.02
R2266:Cyb561d1 UTSW 3 108199404 missense probably damaging 1.00
R4518:Cyb561d1 UTSW 3 108199571 missense possibly damaging 0.95
R6980:Cyb561d1 UTSW 3 108200159 missense probably benign 0.02
R7171:Cyb561d1 UTSW 3 108199363 missense probably damaging 1.00
R7267:Cyb561d1 UTSW 3 108199313 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTACAACCACTCCCGGAC -3'
(R):5'- GCTCGATTAGGTCAGTGGAG -3'

Sequencing Primer
(F):5'- GCCCCTCCTCAGCTGAG -3'
(R):5'- ACTCTACAGAGGGCGCTG -3'
Posted On2016-11-09