Mutagenetix > Incidental Mutation

Incidental Mutation 'R5798:Homer1'

447320

Institutional Source

Beutler Lab

Gene Symbol

Homer1

Ensembl Gene

ENSMUSG00000007617

Gene Name

homer scaffolding protein 1

Synonyms

PSD-Zip45, Ves-1

MMRRC Submission

043210-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R5798 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93436143-93541637 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 93538603 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 311 (R311S)

Ref Sequence

ENSEMBL: ENSMUSP00000050471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060490] [ENSMUST00000079086] [ENSMUST00000080127] [ENSMUST00000109495] [ENSMUST00000109496] [ENSMUST00000109497] [ENSMUST00000109498]

AlphaFold

Q9Z2Y3

Predicted Effect

probably damaging
Transcript: ENSMUST00000060490
AA Change: R311S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050471
Gene: ENSMUSG00000007617
AA Change: R311S

Domain	Start	End	E-Value	Type
WH1	1	107	4.27e-46	SMART
low complexity region	255	268	N/A	INTRINSIC
PDB:3CVE\|D	290	354	2e-34	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000079086
AA Change: R327S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000078093
Gene: ENSMUSG00000007617
AA Change: R327S

Domain	Start	End	E-Value	Type
WH1	17	123	2.73e-44	SMART
low complexity region	271	284	N/A	INTRINSIC
PDB:3CVE\|D	306	370	3e-34	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000080127
AA Change: R323S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000079026
Gene: ENSMUSG00000007617
AA Change: R323S

Domain	Start	End	E-Value	Type
WH1	1	107	4.27e-46	SMART
low complexity region	267	280	N/A	INTRINSIC
PDB:3CVE\|D	302	366	2e-34	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000109495

SMART Domains

Protein: ENSMUSP00000105121
Gene: ENSMUSG00000007617

Domain	Start	End	E-Value	Type
WH1	1	107	4.27e-46	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109496
AA Change: R181S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000105122
Gene: ENSMUSG00000007617
AA Change: R181S

Domain	Start	End	E-Value	Type
WH1	1	107	1.01e-38	SMART
low complexity region	125	138	N/A	INTRINSIC
PDB:3CVE\|D	160	224	2e-35	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000109497
AA Change: R137S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105123
Gene: ENSMUSG00000007617
AA Change: R137S

Domain	Start	End	E-Value	Type
low complexity region	81	94	N/A	INTRINSIC
PDB:3CVE\|D	116	180	9e-36	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000109498
AA Change: R149S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105124
Gene: ENSMUSG00000007617
AA Change: R149S

Domain	Start	End	E-Value	Type
low complexity region	93	106	N/A	INTRINSIC
PDB:3CVE\|D	128	192	9e-36	PDB

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit an increase in spontaneous calcium influx in pancreatic acinar cells. Mice homozygous for a knock-out allele exhibit decreased response to formalin-induced pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,616,929 (GRCm39)	Y1226*	probably null	Het
Ankle2	A	G	5: 110,399,401 (GRCm39)	Y587C	probably damaging	Het
Ankrd52	T	A	10: 128,223,479 (GRCm39)	M697K	probably benign	Het
Arhgef40	G	T	14: 52,234,489 (GRCm39)	A931S	probably damaging	Het
Atp9a	A	G	2: 168,532,884 (GRCm39)		probably null	Het
Ccdc169	T	C	3: 55,047,545 (GRCm39)	V12A	possibly damaging	Het
Ces3b	T	A	8: 105,815,072 (GRCm39)	C284S	probably damaging	Het
Crocc	TCTGAGCTGCTGAGCTGC	TCTGAGCTGC	4: 140,769,118 (GRCm39)		probably null	Het
Ecel1	A	T	1: 87,079,205 (GRCm39)	M491K	probably damaging	Het
Gnaz	C	T	10: 74,850,703 (GRCm39)	R243W	probably damaging	Het
Myo5c	A	G	9: 75,191,480 (GRCm39)	D1118G	probably benign	Het
Or14j10	A	G	17: 37,934,881 (GRCm39)	V215A	probably benign	Het
Or52e7	A	C	7: 104,685,344 (GRCm39)	K313T	probably benign	Het
Pecam1	C	T	11: 106,586,658 (GRCm39)	E185K	possibly damaging	Het
Rfx2	A	T	17: 57,111,362 (GRCm39)	V70E	possibly damaging	Het
Sdk2	G	A	11: 113,717,942 (GRCm39)	T1474M	probably damaging	Het
Slc39a12	G	A	2: 14,454,637 (GRCm39)	A516T	probably damaging	Het
Tanc2	TGCAGCAGCAGCAGCAGCAGCAGC	TGCAGCAGCAGCAGCAGCAGC	11: 105,812,681 (GRCm39)		probably benign	Het
Timd2	T	C	11: 46,568,064 (GRCm39)	I243M	probably benign	Het
Vmn2r108	A	T	17: 20,692,545 (GRCm39)	S104T	probably benign	Het
Vmn2r56	T	C	7: 12,446,892 (GRCm39)	N420S	probably benign	Het
Zfp148	T	C	16: 33,316,513 (GRCm39)	I353T	probably benign	Het

Other mutations in Homer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Homer1	APN	13	93,524,196 (GRCm39)	splice site	probably benign
IGL00427:Homer1	APN	13	93,538,622 (GRCm39)	missense	probably benign	0.05
IGL00479:Homer1	APN	13	93,483,156 (GRCm39)	missense	probably damaging	1.00
PIT4151001:Homer1	UTSW	13	93,485,724 (GRCm39)	missense	probably damaging	1.00
R0153:Homer1	UTSW	13	93,528,254 (GRCm39)	missense	possibly damaging	0.92
R3025:Homer1	UTSW	13	93,538,582 (GRCm39)	nonsense	probably null
R3437:Homer1	UTSW	13	93,502,929 (GRCm39)	intron	probably benign
R4418:Homer1	UTSW	13	93,538,577 (GRCm39)	missense	probably damaging	1.00
R4666:Homer1	UTSW	13	93,538,667 (GRCm39)	missense	probably damaging	0.99
R4718:Homer1	UTSW	13	93,528,272 (GRCm39)	missense	probably damaging	1.00
R5413:Homer1	UTSW	13	93,528,287 (GRCm39)	missense	probably benign	0.01
R5665:Homer1	UTSW	13	93,492,610 (GRCm39)	missense	probably benign	0.03
R6092:Homer1	UTSW	13	93,502,945 (GRCm39)	intron	probably benign
R6486:Homer1	UTSW	13	93,528,233 (GRCm39)	missense	possibly damaging	0.73
R6617:Homer1	UTSW	13	93,478,370 (GRCm39)	missense	probably damaging	1.00
R7101:Homer1	UTSW	13	93,492,562 (GRCm39)	missense	probably benign	0.00
R7384:Homer1	UTSW	13	93,529,547 (GRCm39)	missense	possibly damaging	0.90
R8362:Homer1	UTSW	13	93,502,797 (GRCm39)	missense	unknown
R8772:Homer1	UTSW	13	93,528,239 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATGAAGTTGAATGTCAGAGGC -3'
(R):5'- GTGCAATCTTGGTACGGAGC -3'

Sequencing Primer
(F):5'- GGCACAGCCTGATTGTCAG -3'
(R):5'- TCTTGGTACGGAGCCCAAACAG -3'

Posted On

2016-12-15