Incidental Mutation 'R5781:Msx2'
ID 447749
Institutional Source Beutler Lab
Gene Symbol Msx2
Ensembl Gene ENSMUSG00000021469
Gene Name msh homeobox 2
Synonyms Hox-8, Hox8.1, Hox8
MMRRC Submission 043378-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5781 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 53620917-53626816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53626644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 35 (A35S)
Ref Sequence ENSEMBL: ENSMUSP00000021922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021922]
AlphaFold Q03358
Predicted Effect probably benign
Transcript: ENSMUST00000021922
AA Change: A35S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021922
Gene: ENSMUSG00000021469
AA Change: A35S

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
HOX 142 204 3.2e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188606
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the muscle segment homeobox gene family. The encoded protein is a transcriptional repressor whose normal activity may establish a balance between survival and apoptosis of neural crest-derived cells required for proper craniofacial morphogenesis. The encoded protein may also have a role in promoting cell growth under certain conditions and may be an important target for the RAS signaling pathways. Mutations in this gene are associated with parietal foramina 1 and craniosynostosis type 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective skull ossification with persistent calvarial foramen, alopecia, stubby and curly whiskers, seizures, and impaired development of teeth, cerebellum, and mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 109,992,813 (GRCm39) L1617P probably damaging Het
Abhd16b T C 2: 181,135,947 (GRCm39) V283A probably damaging Het
Adamts19 G T 18: 58,971,040 (GRCm39) R208L possibly damaging Het
Adamts4 T C 1: 171,078,584 (GRCm39) I56T possibly damaging Het
Alpk1 A C 3: 127,473,684 (GRCm39) V773G possibly damaging Het
Arhgap10 G T 8: 78,177,336 (GRCm39) Q100K possibly damaging Het
Arhgef18 T A 8: 3,489,439 (GRCm39) probably null Het
Asb15 A T 6: 24,564,377 (GRCm39) H277L probably benign Het
Ascc3 T A 10: 50,514,074 (GRCm39) V291E probably damaging Het
Cnot6l A C 5: 96,234,024 (GRCm39) V329G probably benign Het
Col14a1 A G 15: 55,286,908 (GRCm39) T910A unknown Het
Dhdds G A 4: 133,724,141 (GRCm39) L58F probably damaging Het
Dsc2 A G 18: 20,165,567 (GRCm39) I846T probably benign Het
Evc A T 5: 37,483,914 (GRCm39) S129T probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Fyco1 A G 9: 123,623,898 (GRCm39) V1377A probably damaging Het
Haus6 C T 4: 86,519,500 (GRCm39) A203T possibly damaging Het
Hkdc1 T G 10: 62,253,712 (GRCm39) D23A probably damaging Het
Hpdl C T 4: 116,677,775 (GRCm39) V229M probably damaging Het
Hspa12a T C 19: 58,810,518 (GRCm39) Y175C probably damaging Het
Hyal1 C T 9: 107,454,866 (GRCm39) P59S probably damaging Het
Itpr1 G A 6: 108,487,699 (GRCm39) C2374Y probably benign Het
Kmt2a A T 9: 44,759,139 (GRCm39) Y114* probably null Het
Mc2r A T 18: 68,540,468 (GRCm39) I275K probably damaging Het
Mc2r A T 18: 68,540,466 (GRCm39) Y276N possibly damaging Het
Mlycd A G 8: 120,137,019 (GRCm39) Y413C probably damaging Het
Mocs2 T G 13: 114,957,455 (GRCm39) S86R probably damaging Het
Or6c201 A T 10: 128,969,016 (GRCm39) L207H probably damaging Het
Pla2g4f C A 2: 120,135,504 (GRCm39) S390I probably damaging Het
Plcl1 C T 1: 55,735,148 (GRCm39) A163V possibly damaging Het
Pnn T C 12: 59,118,605 (GRCm39) V396A probably damaging Het
Rbmxl1 G A 8: 79,232,270 (GRCm39) probably benign Het
Recql G T 6: 142,311,344 (GRCm39) probably null Het
Rev3l T A 10: 39,699,089 (GRCm39) N1195K probably benign Het
Rfwd3 G A 8: 111,999,716 (GRCm39) T754M probably benign Het
Sctr A G 1: 119,959,350 (GRCm39) T98A probably damaging Het
Sdk1 T A 5: 141,921,803 (GRCm39) D6E probably benign Het
Smpdl3a T A 10: 57,684,034 (GRCm39) I264K possibly damaging Het
Spag6 A G 2: 18,736,804 (GRCm39) I154V probably benign Het
Tbc1d12 A C 19: 38,871,127 (GRCm39) T297P probably benign Het
Tgfb1 A G 7: 25,396,385 (GRCm39) D226G probably benign Het
Ubr3 G T 2: 69,846,588 (GRCm39) probably null Het
Ubr4 T C 4: 139,195,407 (GRCm39) Y1210H probably damaging Het
Ubr5 T C 15: 38,006,785 (GRCm39) T1157A probably benign Het
Vmn2r120 T G 17: 57,831,938 (GRCm39) T284P probably benign Het
Vps13b G T 15: 35,794,181 (GRCm39) A2286S probably damaging Het
Zcchc14 A T 8: 122,331,332 (GRCm39) probably benign Het
Zfr2 T A 10: 81,079,547 (GRCm39) V362E probably benign Het
Other mutations in Msx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Msx2 APN 13 53,622,638 (GRCm39) splice site probably benign
duke UTSW 13 53,622,431 (GRCm39) missense probably damaging 1.00
R0448:Msx2 UTSW 13 53,622,431 (GRCm39) missense probably damaging 1.00
R1833:Msx2 UTSW 13 53,622,221 (GRCm39) missense probably damaging 0.99
R8290:Msx2 UTSW 13 53,622,528 (GRCm39) missense probably damaging 0.99
X0022:Msx2 UTSW 13 53,622,402 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTCCGACTTGACCGAGGC -3'
(R):5'- AGTTGGTTGAGCCGAGTCTC -3'

Sequencing Primer
(F):5'- TCTCGAAGGGCTTGACGAG -3'
(R):5'- ACTTCCCCTCGGAGGACAG -3'
Posted On 2016-12-15