Incidental Mutation 'R5836:Cd8a'
ID449587
Institutional Source Beutler Lab
Gene Symbol Cd8a
Ensembl Gene ENSMUSG00000053977
Gene NameCD8 antigen, alpha chain
SynonymsLy-35, Lyt-2, Ly-B, Ly-2
MMRRC Submission 043222-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R5836 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71373427-71379173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71373791 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000131873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066747] [ENSMUST00000172321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066747
AA Change: V80A

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068123
Gene: ENSMUSG00000053977
AA Change: V80A

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172321
AA Change: V80A

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131873
Gene: ENSMUSG00000053977
AA Change: V80A

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205054
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G T 17: 35,962,026 A243D possibly damaging Het
Azin2 C T 4: 128,948,877 G223D probably damaging Het
Babam1 A G 8: 71,403,043 E260G probably benign Het
Brwd1 A T 16: 96,064,758 S275T probably damaging Het
Clec4a3 T C 6: 122,952,902 F12S possibly damaging Het
Dnah5 A C 15: 28,383,592 N2987H probably damaging Het
Dock9 A G 14: 121,681,351 F78S probably damaging Het
Eml3 A G 19: 8,941,295 T885A possibly damaging Het
Esr1 T C 10: 4,712,817 V145A probably benign Het
Gm5108 A G 5: 67,944,610 T30A probably benign Het
Gpr179 T C 11: 97,339,056 S758G probably benign Het
Heatr1 T A 13: 12,408,736 L538Q probably damaging Het
Ikzf2 A G 1: 69,539,387 I176T probably damaging Het
Lrp3 A G 7: 35,203,322 V533A probably damaging Het
Nkx2-5 A T 17: 26,839,089 V297E possibly damaging Het
Olfr1388 T C 11: 49,444,526 L225P probably damaging Het
Olfr525 G A 7: 140,322,914 V72I probably benign Het
Olfr937 T C 9: 39,060,622 T15A probably benign Het
Pclo T A 5: 14,678,535 L2469Q probably benign Het
Pdgfra T C 5: 75,163,774 W97R possibly damaging Het
Plekha5 T C 6: 140,426,524 Y67H probably damaging Het
Plin5 A T 17: 56,115,549 probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prickle1 T A 15: 93,503,017 K529* probably null Het
Ptbp2 G A 3: 119,726,097 T107I probably damaging Het
Ptpn12 C T 5: 21,009,546 W197* probably null Het
Rhobtb1 T C 10: 69,269,989 V190A probably damaging Het
Ryr2 T C 13: 11,603,732 T3866A probably damaging Het
Serpina3m T C 12: 104,389,250 Y59H probably damaging Het
Slc12a6 T C 2: 112,341,998 V414A possibly damaging Het
Slc34a1 T C 13: 55,413,465 M581T probably benign Het
Slco1c1 A G 6: 141,569,314 Y645C probably damaging Het
St5 A T 7: 109,541,345 S225T possibly damaging Het
Stoml1 T C 9: 58,260,840 L278P probably benign Het
Tecpr2 C T 12: 110,931,511 A399V possibly damaging Het
Tmem229a T C 6: 24,955,017 E246G probably damaging Het
Vmn1r224 A T 17: 20,419,691 I177L probably benign Het
Zswim5 C T 4: 116,984,803 T860I probably benign Het
Other mutations in Cd8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cd8a APN 6 71373707 missense probably benign 0.04
IGL02342:Cd8a APN 6 71373739 missense probably damaging 1.00
alfalfa UTSW 6 71373728 missense probably damaging 0.99
wenzhou UTSW 6 71373872 missense probably benign 0.02
R0212:Cd8a UTSW 6 71373649 missense probably benign 0.01
R1158:Cd8a UTSW 6 71373728 missense probably damaging 0.99
R1813:Cd8a UTSW 6 71373963 missense possibly damaging 0.47
R4541:Cd8a UTSW 6 71373872 missense probably benign 0.02
R6390:Cd8a UTSW 6 71373929 missense probably damaging 0.97
Z1088:Cd8a UTSW 6 71373686 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCTGGGTGAGTCGATTATCC -3'
(R):5'- TTTCTGAAGGACTGGCACG -3'

Sequencing Primer
(F):5'- TTATCCTGGGGAGTGGAGAAGC -3'
(R):5'- ACTGAAGTACATCACCGAGTTG -3'
Posted OnDec 20, 2016