Incidental Mutation 'R5824:Moxd1'
ID450075
Institutional Source Beutler Lab
Gene Symbol Moxd1
Ensembl Gene ENSMUSG00000020000
Gene Namemonooxygenase, DBH-like 1
Synonyms3230402N08Rik
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24223517-24302790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24287097 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 486 (I486F)
Ref Sequence ENSEMBL: ENSMUSP00000093460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095784]
Predicted Effect probably damaging
Transcript: ENSMUST00000095784
AA Change: I486F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093460
Gene: ENSMUSG00000020000
AA Change: I486F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DoH 59 148 7.89e-15 SMART
Pfam:Cu2_monooxygen 186 315 2.7e-50 PFAM
Pfam:Cu2_monoox_C 334 491 2.1e-48 PFAM
low complexity region 602 613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Moxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL00227:Moxd1 APN 10 24282593 missense probably damaging 1.00
IGL00331:Moxd1 APN 10 24282555 splice site probably benign
IGL01074:Moxd1 APN 10 24279384 missense probably benign 0.45
IGL01462:Moxd1 APN 10 24244388 critical splice donor site probably null
IGL01777:Moxd1 APN 10 24252596 missense probably benign 0.00
IGL02051:Moxd1 APN 10 24253018 splice site probably null
IGL02272:Moxd1 APN 10 24282700 nonsense probably null
IGL02343:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL02425:Moxd1 APN 10 24279436 missense probably benign 0.01
IGL02448:Moxd1 APN 10 24282719 missense probably damaging 0.99
IGL02452:Moxd1 APN 10 24282752 missense probably damaging 1.00
IGL03301:Moxd1 APN 10 24279484 missense probably damaging 0.99
R0631:Moxd1 UTSW 10 24252954 missense probably damaging 1.00
R1436:Moxd1 UTSW 10 24244358 missense probably damaging 1.00
R1484:Moxd1 UTSW 10 24223860 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1713:Moxd1 UTSW 10 24281496 missense probably damaging 1.00
R1954:Moxd1 UTSW 10 24279883 missense probably benign 0.17
R3115:Moxd1 UTSW 10 24301531 nonsense probably null
R3116:Moxd1 UTSW 10 24301531 nonsense probably null
R5183:Moxd1 UTSW 10 24279547 critical splice donor site probably null
R5183:Moxd1 UTSW 10 24287136 missense probably damaging 1.00
R5322:Moxd1 UTSW 10 24244253 missense possibly damaging 0.88
R5728:Moxd1 UTSW 10 24223683 missense possibly damaging 0.92
R6158:Moxd1 UTSW 10 24284777 missense probably damaging 1.00
R6322:Moxd1 UTSW 10 24284811 missense probably damaging 1.00
R6662:Moxd1 UTSW 10 24284760 missense probably damaging 1.00
R6827:Moxd1 UTSW 10 24279850 missense probably benign 0.29
R6928:Moxd1 UTSW 10 24300288 missense probably damaging 1.00
R7048:Moxd1 UTSW 10 24281476 missense probably damaging 1.00
X0063:Moxd1 UTSW 10 24252500 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCCTCTCCTTGCAAATGATAACG -3'
(R):5'- CTGGACATGGCAACCAAGTTTAC -3'

Sequencing Primer
(F):5'- TGCATTTCAGAATTGAGTGGATC -3'
(R):5'- CTTGGTCTCCTGAGTGCCAAG -3'
Posted On2016-12-20