Incidental Mutation 'R5724:Crebbp'
ID452404
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5724 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 4087635 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765] [ENSMUST00000206098]
Predicted Effect probably benign
Transcript: ENSMUST00000023165
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191387
Predicted Effect probably benign
Transcript: ENSMUST00000205344
Predicted Effect probably benign
Transcript: ENSMUST00000205765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205945
Predicted Effect probably benign
Transcript: ENSMUST00000206098
Predicted Effect probably benign
Transcript: ENSMUST00000206464
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Adprhl2 G T 4: 126,318,076 Q148K probably damaging Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Bpifb1 C A 2: 154,204,792 H77Q probably benign Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fer C A 17: 63,924,157 T301K probably damaging Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Pccb C T 9: 100,987,847 V307I probably benign Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Ppp2r3c A T 12: 55,297,832 M117K probably benign Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tasp1 T C 2: 140,057,419 K5E probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
R7568:Crebbp UTSW 16 4126489 missense probably benign 0.34
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATACCCTGGAACCCCTG -3'
(R):5'- AGACAAGCACTGGGAATTCTC -3'

Sequencing Primer
(F):5'- GTTCTACAGAGCTCTTTCCAGTCAG -3'
(R):5'- TTCCTTACGCCGCTCCAAATG -3'
Posted On2017-01-03